HITI: The NHEJ-Powered CRISPR Strategy Revolutionizing Gene Therapy and Cell Engineering

Abstract

Homology-Independent Targeted Insertion (HITI) is a CRISPR/Cas9-based genome-editing technique that leverages the non-homologous end joining (NHEJ) pathway for targeted transgene integration. Unlike homology-directed repair (HDR), HITI is active in both dividing and non-dividing cells, offering significant advantages for therapeutic applications in quiescent tissues and clinical-scale manufacturing. This article explores the foundational mechanisms of HITI, its diverse methodological applications from CAR-T cell engineering to in vivo gene correction, current challenges in efficiency and specificity, and emerging optimization strategies. We provide a comparative analysis against HDR and other knock-in methods, validating HITI's potential to broaden access to advanced gene and cell therapies.

Beyond HDR: Understanding HITI's NHEJ Mechanism and Core Principles

The advent of CRISPR-Cas9 technology has revolutionized biological research and therapeutic development by enabling precise genome editing. Within this field, two principal DNA repair mechanisms are harnessed for introducing genetic modifications: homology-directed repair (HDR) and non-homologous end joining (NHEJ). While HDR has long been the gold standard for precise gene editing, its fundamental limitations have spurred the development of alternative strategies. Homology-independent targeted insertion (HITI) represents a paradigm shift in genome editing approaches by leveraging the NHEJ pathway to overcome the cell cycle restrictions and efficiency barriers inherent to HDR. This Application Note delineates the mechanistic distinctions between HITI and HDR, provides quantitative comparisons of their performance across biological systems, and details optimized protocols for implementing HITI in both basic research and therapeutic contexts, framed within the broader thesis that HITI significantly expands the accessible cell types and applications for precision genome editing.

Fundamental Mechanisms: How HITI and HDR Differ at the Molecular Level

DNA Repair Pathway Utilization

The fundamental distinction between HITI and HDR lies in their utilization of different cellular DNA repair machineries. HDR is a high-fidelity repair pathway that requires a homologous DNA template to precisely repair double-strand breaks (DSBs). This pathway is active primarily during the S and G2 phases of the cell cycle when a sister chromatid is available to serve as a repair template [1]. Consequently, HDR efficiency is significantly limited in non-dividing or slowly proliferating cells, including neurons, cardiomyocytes, and stem cells in certain states [1] [2].

In contrast, HITI strategically co-opts the NHEJ pathway, which is the predominant DSB repair mechanism in mammalian cells throughout all phases of the cell cycle [3]. NHEJ functions independently of homologous templates by directly ligating broken DNA ends, albeit with the potential for introducing small insertions or deletions (indels) [1]. HITI leverages this ubiquitous cellular pathway by designing donor DNA constructs with Cas9 target sequences that mirror those in the genomic locus of interest, enabling NHEJ-mediated integration of the donor fragment [2] [4].

Table 1: Core Mechanistic Differences Between HDR and HITI

Feature	HDR	HITI
DNA Repair Pathway	Homology-directed repair	Non-homologous end joining
Cell Cycle Dependence	S/G2 phases only [5]	All phases [3]
Template Requirement	Homology arms (typically 500-1000 bp)	No homology arms; uses Cas9 target sites
Editing Efficiency in Non-dividing Cells	Low [2]	High [2]
Directional Control	Intrinsic via homology arms	Engineered through inverted Cas9 target sites [2]
Theoretical Background Mutation Rate	Low	Higher (due to NHEJ)

Donor DNA Design and Integration Mechanism

The molecular architecture of donor DNA constructs differs substantially between HDR and HITI approaches. HDR donor templates contain homology arms—sequences identical to the regions flanking the target DSB—which facilitate strand invasion and template-directed repair [1]. These homology arms typically range from 500 to 1000 base pairs in length, imposing significant constraints on vector design and packaging capacity, particularly for adeno-associated virus (AAV) vectors with limited payload capacity [2].

HITI donor constructs eliminate the need for extensive homology arms, instead flanking the payload sequence with Cas9 recognition sites that are inverted relative to the genomic target site [2] [4]. This strategic inversion ensures that correctly oriented integration destroys the Cas9 cut site, protecting the integrated fragment from repeated cleavage, while inversely integrated constructs retain functional Cas9 targets and undergo repeated cleavage cycles until correct orientation is achieved [2]. This self-correcting mechanism drives high-fidelity integration without the molecular machinery required for homologous recombination.

Diagram 1: Molecular mechanisms of HDR and HITI. HDR requires multiple coordinated steps including resection, strand invasion, and synthesis using extensive homology arms. HITI utilizes simultaneous cleavage and NHEJ-mediated ligation with a self-correcting orientation check.

Quantitative Comparison: HITI Versus HDR Performance Metrics

Editing Efficiency Across Cell Types

Empirical studies across diverse biological systems consistently demonstrate HITI's superior editing efficiency in non-dividing cell populations. In therapeutic T-cell engineering, HITI-mediated chimeric antigen receptor (CAR) integration into the TRAC locus yielded at least 2-fold higher cell yields compared to HDR approaches [5]. This efficiency advantage was particularly pronounced when using large DNA templates exceeding 5 kb, where HITI achieved significantly higher knock-in rates than HDR in adherent cell lines and embryonic stem cells [5].

In vivo applications further highlight HITI's advantages. When delivered via lipid nanoparticles to mouse hepatocytes, HITI demonstrated superior knock-in efficiency compared to HDR for integrating a GFP reporter at the albumin locus [6]. Similarly, HITI achieved stable transgene integration in both retinal photoreceptors (non-dividing cells) and neonatal hepatocytes (dividing cells), whereas HDR efficiency was substantially limited in post-mitotic retinal cells [2]. This versatility across tissue types underscores HITI's independence from cell proliferation status.

Table 2: Efficiency Comparison of HITI vs. HDR Across Experimental Systems

Experimental System	Target	HITI Efficiency	HDR Efficiency	Fold Improvement
Primary Human T-cells [5]	TRAC locus (CAR integration)	High (2-fold higher yields)	Baseline	2×
Mouse Hepatocytes (LNP delivery) [6]	Albumin locus (GFP knock-in)	Superior knock-in	Lower efficiency	Not specified
Retinal Photoreceptors (AAV delivery) [2]	Rhodopsin locus	4.2-4.7% of transfected cells	Limited (cell cycle dependent)	Substantial in non-dividing cells
Embryonic Stem Cells [5]	Various loci (large transgenes)	High efficiency	Lower efficiency	Pronounced with >5 kb inserts
Duchenne Muscular Dystrophy Model [4]	DMD intron 19	1.4% of genomes (heart)	Not applicable (muscle has low HDR)	Essentially only option in muscle

Therapeutic Applications and Outcomes

The therapeutic potential of HITI extends across diverse disease models, particularly for conditions affecting non-dividing tissues or requiring large transgene integration. In a mouse model of autosomal dominant retinitis pigmentosa caused by rhodopsin mutations, HITI-mediated replacement of mutant alleles achieved correction in 4.2-11.8% of photoreceptors, resulting in significant improvements to retinal structure and function [2]. Similarly, in a diet-induced obesity model, a single administration of HITI editing reagents enabled stable integration and secretion of GLP-1 receptor agonist Exendin-4, leading to sustained weight reduction and improved metabolic parameters [6].

For monogenic disorders, HITI has demonstrated particular promise in Duchenne muscular dystrophy (DMD), where HDR is inefficient in muscle tissue. A HITI-based approach correcting mutations upstream of DMD intron 19 achieved editing in 1.4% of cardiac genomes, restoring 30% of normal transcript levels and 11% dystrophin protein expression—therapeutically meaningful correction for this severe disorder [4]. This approach potentially addresses approximately 25% of DMD cases, highlighting the broad applicability of HITI for genetic medicine.

Successful implementation of HITI requires carefully selected molecular tools and delivery systems. The core components include Cas9 nucleases with appropriate expression systems, guide RNAs targeting both genomic loci and donor constructs, specialized donor vectors, and delivery vehicles optimized for specific applications.

Table 3: Essential Research Reagent Solutions for HITI

Reagent Category	Specific Examples	Function and Application Notes
Cas9 Expression System	SpCas9 (Addgene #41815) [6], SaCas9 [4]	Creates DSBs at target loci; SpCas9 for general use, smaller SaCas9 for AAV packaging
Donor Vector Backbone	Nanoplasmid (~450 bp) [5] [3], HITI backbone (Addgene #87116) [6]	Minimized backbone reduces cytotoxicity and improves delivery efficiency; R6K origin enables antibiotic-free selection
Delivery Vehicles	AAV9 (in vivo) [2] [4], Lipid nanoparticles (LNP) [6], Electroporation (ex vivo) [5]	AAV9 for systemic delivery; LNPs for hepatocytes; Electroporation for T-cells and primary cells
Enrichment Systems	DHFR-FS [5] [3], tEGFR/tNGFR [3]	DHFR-FS provides methotrexate resistance for selection; surface markers enable magnetic sorting
Guide RNA Design	TRAC-targeting: GGGAATCAAAATCGGTGAAT [5], Albumin-targeting: GTTGTGATGTGTTTAGGCTAAGG [6]	Targets therapeutic loci with high efficiency and minimal off-target effects; verified in published studies

Detailed Experimental Protocols

HITI-Mediated CAR-T Cell Engineering Protocol

This protocol describes HITI-mediated knock-in of a chimeric antigen receptor (CAR) into the TRAC locus of primary human T-cells, generating therapeutic cell products with high efficiency and purity [5].

Day 0: T-Cell Isolation and Activation

• Isolate primary human T-cells from leukopaks using negative selection (EasySep Human T Cell Isolation Kit).
• Activate T-cells using Dynabeads Human T-Activator CD3/CD28 at a 1:1 bead-to-cell ratio.
• Culture cells in TexMACS medium supplemented with IL-7 (12.5 ng/mL) and IL-15 (12.5 ng/mL), plus 3% human male AB serum.
• Maintain cell density at approximately 1.5 × 10^6 cells/mL in G-Rex plates.

Day 2: Electroporation and HITI Knock-In

• Remove Dynabeads magnetically and count cells.
• Wash cells once in electroporation buffer (Maxcyte).
• Resuspend cells at 2 × 10^8 cells/mL in electroporation buffer.
• Prepare RNP complex:
  • Mix wildtype Cas9 (61 µM) with TRAC-targeting sgRNA (125 µM) at 1:1 volume ratio (2:1 molar ratio).
  • Incubate for 10 minutes at room temperature.
  • Add nanoplasmid DNA (3 mg/mL) containing CAR construct with internal sgRNA target sites.
  • Incubate additional 10 minutes to allow RNP cleavage of nanoplasmid.
• Combine cell suspension with RNP/nanoplasmid mixture.
• Electroporate using Maxcyte GTx with "Expanded T cell 4" protocol for activated T-cells.
• Rest cells in electroporation buffer for 30 minutes post-electroporation.
• Transfer to final G-Rex vessels with complete medium.

Days 3-14: Expansion and Enrichment

• Continue culture with IL-7 and IL-15 supplementation.
• For enrichment using DHFR-FS system:
  • Add methotrexate (MTX) at optimized concentrations (typically 0.1-1 µM) on day 5 post-electroporation.
  • Maintain MTX selection for 72 hours, then return to standard medium.
• Monitor CAR expression by flow cytometry starting day 7.
• Expand cells for 14-day total process, maintaining density at 1-1.5 × 10^6 cells/mL.
• Harvest cells achieving typical yields of 5.5 × 10^8 to 3.6 × 10^9 CAR-positive T-cells from 5 × 10^8 starting population.

Diagram 2: HITI CAR-T cell manufacturing workflow. This 14-day process generates therapeutically relevant doses of engineered T-cells through HITI-mediated CAR integration and subsequent enrichment.

In Vivo HITI for Therapeutic Transgene Integration

This protocol describes AAV-mediated HITI for stable transgene integration in mouse liver, enabling sustained therapeutic protein secretion [6] [2].

Vector Design and Production

• Design HITI donor vector containing:
  • Therapeutic transgene (e.g., Exendin-4, dystrophin mini-gene)
  • Flanking sgRNA target sites (inverted relative to genomic targets)
  • Appropriate promoter (e.g., CAG, MHCK7) and polyadenylation signal
  • STOP codons in all reading frames upstream of start codon (for endogenous gene knockout)
• Clone sgRNA expression cassette targeting genomic locus (e.g., albumin locus for hepatocyte expression)
• Package HITI donor and Cas9 expression constructs into appropriate AAV serotypes (AAV9 for systemic delivery)
• Purify and quantify AAV vectors using standard methods

In Vivo Delivery

• For mouse studies, use 8-12 week old animals (Balb/c for metabolic studies, C57BL/6 for disease models)
• Administer AAV vectors via systemic injection (tail vein) at total dose of 2.0-2.9 × 10^14 vg/kg
• Use Cas9:donor vector ratio of 1:5 for optimal knock-in efficiency [4]
• Include appropriate control groups (e.g., scramble gRNA, vehicle injection)

Analysis and Validation

• Monitor therapeutic outcomes longitudinally (e.g., blood glucose, body weight, disease parameters)
• At experimental endpoint, harvest target tissues (liver, heart, skeletal muscle)
• Quantify knock-in efficiency by ddPCR using primers specific to integration junctions
• Assess transcript correction by RT-ddPCR or RNA sequencing
• Evaluate protein expression by immunofluorescence, western blot, or immunohistochemistry
• Analyze potential off-target effects by GUIDE-seq or similar unbiased methods
• Examine genomic integrity at integration site by long-range PCR and sequencing

Troubleshooting and Optimization Guidelines

Successful HITI implementation requires careful optimization of several critical parameters. When encountering low knock-in efficiency, consider the following evidence-based adjustments:

Electroporation Parameters (for ex vivo applications): Optimize cell concentration (2 × 10^8 cells/mL), RNP:DNA ratio (2:1 molar ratio Cas9:sgRNA), and nanoplasmid concentration. Use the "Expanded T cell 4" protocol on Maxcyte GTx for activated T-cells or "Resting T cell 14-3" protocol for non-activated T-cells [5].

AAV Dosing Ratios (for in vivo applications): Test different Cas9:donor vector ratios, with 1:5 often providing optimal results [4]. Ensure total dose exceeds 2 × 10^14 vg/kg for efficient hepatocyte transduction.

Enrichment Strategies: Implement CEMENT (CRISPR EnrichMENT) using DHFR-FS selection with methotrexate (0.1-1 µM for 72 hours) to increase CAR-T cell purity to approximately 80% [5]. Alternative surface markers (tEGFR, tNGFR) enable magnetic enrichment but may reduce final cell yields.

Donor Design Optimization: For difficult-to-express transgenes, test different start codons and regulatory elements. Kozak sequences generally provide robust expression, while small synthetic IRES elements may be superior for specific applications [2].

HITI represents a transformative approach to precision genome editing that effectively addresses the fundamental limitations of HDR, particularly in non-dividing cells and tissues with low proliferative capacity. By leveraging the ubiquitous NHEJ pathway and incorporating a self-correcting mechanism for directional integration, HITI expands the possible applications of therapeutic genome editing to include previously intractable targets such as neurons, cardiomyocytes, and quiescent tissue stem cells. The protocols and guidelines presented herein provide researchers with robust methodologies for implementing HITI across diverse experimental systems, from ex vivo engineering of therapeutic cell products to in vivo correction of genetic disorders. As the field advances, further optimization of HITI efficiency and fidelity will undoubtedly unlock new therapeutic possibilities for genetic diseases that currently lack effective treatments.

Homology-Independent Targeted Insertion (HITI) represents a revolutionary approach in CRISPR-Cas9-mediated genome editing that leverages the Non-Homologous End Joining (NHEJ) DNA repair pathway. Unlike Homology-Directed Repair (HDR), which is active primarily in the S and G2 phases of the cell cycle, NHEJ functions throughout all cell cycle stages, making it uniquely suitable for editing both dividing and non-dividing cells [1] [3]. This capability is particularly valuable for therapeutic applications in postmitotic cells such as neurons, cardiomyocytes, and quiescent T cells, where HDR efficiency is notoriously low [7] [1].

The fundamental advantage of HITI lies in its exploitation of NHEJ, the predominant DNA repair pathway in mammalian cells. NHEJ is initiated when the Ku heterodimer (Ku70/Ku80) recognizes and binds to double-strand breaks (DSBs), subsequently recruiting DNA-PKcs, Artemis nuclease, and finally the XRCC4-DNA ligase IV complex to ligate the broken ends [1]. This pathway does not require a homologous template and is active in both dividing and non-dividing cells, providing a versatile platform for genetic engineering across diverse cell types [3] [8].

NHEJ vs. HDR: Key Mechanistic Differences

The following diagram illustrates the fundamental mechanistic differences between the HITI (utilizing NHEJ) and HDR pathways, highlighting why NHEJ is active regardless of cell cycle stage:

The NHEJ pathway's cell cycle independence stems from its minimal requirements for DNA end processing. Unlike HDR, which requires extensive 5' to 3' end resection and a sister chromatid template, NHEJ directly ligates broken ends after minimal modification [1]. This fundamental difference enables HITI to achieve efficient gene editing in non-dividing primary T cells, neurons, and cardiomyocytes where HDR efficiency is negligible [7] [3] [5].

Quantitative Assessment of HITI Efficiency Across Cell Types

Table 1: HITI Efficiency Metrics Across Cell Types and Applications

Cell Type	Target Locus	Editing Efficiency	Key Findings	Reference
Primary Human T-cells	TRAC	2-fold higher than HDR	Generated 5.5×10⁸–3.6×10⁹ CAR-T cells from 5×10⁸ starting cells; 80% purity after enrichment	[5]
iPSC-derived Neurons	B2Mg1	N/A	Distinct indel pattern vs. iPSCs; prolonged indel accumulation over 2 weeks	[7]
Mouse Photoreceptors	Rhodopsin	4.2-4.7% DsRed+ cells	Successful HITI in postmitotic retinal cells; 11.8% max efficiency	[2]
Mouse Liver (MPS VI model)	Albumin	Stable transgene expression	Achieved therapeutic enzyme levels in newborn mice	[2]
DMD Mouse Model	DMD intron 19	1.4% genome editing (heart)	Restored 11% normal dystrophin levels; 30% transcript correction	[4]
iPSC-derived Cardiomyocytes	Various	N/A	Weeks-long timeline of indel accumulation similar to neurons	[7]

The data demonstrate HITI's remarkable versatility across diverse cell types. In primary human T-cells, HITI achieved approximately double the knock-in efficiency compared to HDR, enabling clinical-scale manufacturing of CAR-T cells [5]. In postmitotic cells, HITI enabled editing that would be impossible with HDR, though with distinct kinetic patterns—neurons and cardiomyocytes showed prolonged indel accumulation over weeks rather than days [7].

Detailed HITI Protocol for Primary Human T-Cell Engineering

Experimental Workflow for T-Cell Engineering

The following diagram outlines the comprehensive workflow for HITI-mediated CAR integration in primary human T-cells:

Step-by-Step Protocol

Day 1: T-Cell Isolation

• Isolate primary human T-cells from leukopaks using negative selection with the EasySep Human T-Cell Isolation Kit [5].
• Activate T-cells with Dynabeads Human T-Activator CD3/CD28 at a 1:1 bead-to-cell ratio.
• Culture cells in TexMACS medium supplemented with IL-7 (12.5 ng/mL) and IL-15 (12.5 ng/mL), plus 3% human male AB serum.
• Maintain cells at approximately 1.5×10⁶ cells/mL in G-Rex plates.

Day 2: Electroporation

• Magnetically remove Dynabeads and count cells.
• Wash cells once in Maxcyte electroporation buffer and resuspend at 2×10⁸ cells/mL.
• Prepare RNP complex:
  • Mix wild-type Cas9 (61 µM) and sgRNA (125 µM) at a 2:1 molar ratio (sgRNA:Cas9).
  • Incubate for 10 minutes at room temperature.
• Add nanoplasmid DNA (3 mg/mL) to the RNP complex:
  • Use 1 cut site design for optimal efficiency [3].
  • Incubate for 10 minutes to allow RNP to linearize the nanoplasmid.
• Electroporate using Maxcyte GTx with the "Expanded T-Cell 4" protocol for activated T-cells or "Resting T-Cell 14-3" for non-activated T-cells.
• Rest cells in electroporation buffer for 30 minutes post-electroporation before transferring to final G-Rex vessels.

Days 3-14: Selection and Expansion

• Implement CEMENT (CRISPR EnrichMENT) selection starting day 3 post-electroporation:
  • Use methotrexate (MTX) for cells with DHFR-FS selection marker.
  • Apply MTX at optimized concentrations for 5-7 days [5].
• Continue expansion in G-Rex system with regular medium exchanges.
• Harvest cells on day 14 for analysis and cryopreservation.

Critical Optimization Parameters

• Electroporation Conditions: Optimize voltage, pulse width, cell concentration, DNA vector concentration, and Cas9:gRNA ratio for specific experimental needs [3].
• Nanoplasmid Design: Utilize minimal backbone (~430 bp) with R6K origin and antibiotic-free selection system to prevent transgene silencing [5].
• gRNA Selection: Employ tools like COSMID and CCTop for in silico off-target prediction [3]. Select gRNAs with high on-target efficiency and minimal predicted off-target effects.
• Stimulation Timing: For non-activated T-cells, add CD3/CD28 stimulation beads immediately after electroporation to mitigate aneuploidy risks associated with pre-stimulation [3].

The Scientist's Toolkit: Essential Reagents for HITI Experiments

Table 2: Key Research Reagent Solutions for HITI Workflows

Reagent/Category	Specific Examples	Function & Application Notes
CRISPR Components	Wild-type Cas9 protein, synthetic sgRNA	Forms RNP complex for targeted DNA cleavage; 2:1 sgRNA:Cas9 molar ratio recommended
Delivery Vectors	Nanoplasmid DNA, AAV9 vectors	Nanoplasmid ideal for in vitro T-cell work; AAV preferred for in vivo applications
Selection Systems	DHFR-FS with methotrexate, tEGFR, tNGFR	Enriches edited cells; DHFR-FS allows metabolic selection with minimal processing
Electroporation Systems	Maxcyte GTx with CL1.1 assembly	Clinical-scale electroporation; enables closed-system manufacturing
Cell Culture Media	TexMACS with IL-7/IL-15 cytokines	Supports T-cell expansion and maintains central memory phenotype
gRNA Design Tools	COSMID, CCTop, CRISPRme	In silico off-target prediction; CRISPRme accounts for human genetic diversity
Safety Assessment	GUIDE-seq, rhAMPSeq, ddPCR	Detects off-target effects and chromosomal abnormalities

Applications Across Therapeutic Domains

CAR-T Cell Manufacturing

HITI has revolutionized CAR-T cell production by enabling non-viral, site-specific integration into the TRAC locus. This approach generates homogeneous CAR-T cell products with superior efficacy and safety profiles compared to viral random integration [5] [8]. The methodology described in Section 4 consistently produces therapeutically relevant doses of 5.5×10⁸–3.6×10⁹ CAR+ T cells from a starting population of 5×10⁸ cells, meeting clinical dosing requirements [5].

Neurological Disorders

In iPSC-derived neurons, HITI enables editing where HDR fails completely. Studies reveal that neurons resolve Cas9-induced DNA damage over an extended timeframe (up to 2 weeks) compared to dividing cells (days), and upregulate non-canonical DNA repair factors [7]. This prolonged editing window requires adjusted experimental timelines but enables efficient editing in these therapeutically relevant cells.

Inherited Disorders

HITI has shown promising results in correcting mutations in Duchenne Muscular Dystrophy (DMD) models. By targeting intron 19 of the DMD gene, researchers restored dystrophin expression to 11% of normal levels in cardiac tissue—a therapeutically meaningful threshold [4]. Similarly, HITI achieved stable transgene expression in mouse liver and retina, overcoming the limitation of AAV episomal dilution in dividing tissues [2].

Troubleshooting and Technical Considerations

Optimizing HITI Efficiency

• Donor Design: Implement single cut-site designs with inverted gRNA target sequences to ensure proper orientation of integrated fragments [4].
• Component Ratios: Maintain optimal Cas9:donor ratios (1:5 for AAV systems) [4]; for T-cell electroporation, use 3 mg/mL nanoplasmid DNA concentration [5].
• Cell State: Utilize non-activated T-cells for HITI to reduce chromosomal abnormality risks and streamline manufacturing [3].

Safety Assessment

Comprehensive genotoxicity evaluation is essential for clinical translation:

• Off-target Analysis: Employ GUIDE-seq, CIRCLE-seq, or rhAMPSeq to identify and quantify off-target editing [3].
• On-target Characterization: Use long-read sequencing and single primer amplification to detect complex on-target events like large deletions and rearrangements [3].
• Karyotypic Stability: Monitor chromosome 14 integrity in TRAC-edited T-cells using ddPCR to detect aneuploidy [3].

HITI technology represents a paradigm shift in genome editing by leveraging the NHEJ pathway's cell cycle independence to overcome the limitations of HDR-based approaches. The protocols and applications detailed herein provide researchers with robust methodologies for implementing HITI across diverse cell types and therapeutic areas. As the field advances, further optimization of HITI efficiency and fidelity will expand its utility in both basic research and clinical applications, potentially enabling therapies for previously intractable genetic disorders.

Homology-Independent Targeted Integration (HITI) is a CRISPR-Cas9-based genome editing strategy that leverages the non-homologous end joining (NHEJ) pathway for targeted transgene integration. Unlike homology-directed repair (HDR), which requires homologous templates and active cell division, HITI enables efficient DNA knock-in in both dividing and non-dividing cells, making it particularly valuable for editing post-mitotic cells such as neurons and for clinical applications targeting adult tissues [9]. The core components of the HITI system include single-guide RNA (sgRNA) for target specificity, Cas9 nuclease for creating double-strand breaks, and a specialized donor template designed for NHEJ-mediated integration. The optimal design of these three elements is critical for achieving high editing efficiency and fidelity in HITI-based experiments.

sgRNA Design and Optimization

Fundamental Design Principles

The sgRNA is a synthetic RNA chimera composed of a CRISPR RNA (crRNA) segment containing the 20-nucleotide guide sequence, and a trans-activating crRNA (tracrRNA) that serves as a scaffold for Cas9 binding. For HITI applications, the sgRNA must be designed to target both the genomic locus of interest and the corresponding donor template with high specificity [9]. The guide sequence should be positioned immediately 5' to a Protospacer Adjacent Motif (PAM) sequence (NGG for Streptococcus pyogenes Cas9), with the Cas9 nuclease cutting 3-4 base pairs upstream of the PAM site [10].

Deep learning frameworks like DeepCRISPR have demonstrated that sgRNA efficiency is influenced by both sequence features and epigenetic factors [11]. The platform processes approximately 0.68 billion sgRNA sequences with epigenetic information curated from 13 human cell types to predict on-target efficacy and off-target profiles, enabling optimized sgRNA design for specific experimental contexts [11].

Strand Selection and Efficiency Considerations

Emerging evidence indicates that sgRNAs targeting the transcriptionally active strand generally show higher NHEJ frequencies compared to those targeting the transcriptionally inactive strand [12]. In one systematic study, guide RNAs targeting the transcriptionally active strand demonstrated significantly higher NHEJ frequencies (up to 27%) compared to those targeting the inactive strand (approximately 5%-7%) [12]. This finding has particular relevance for HITI, which specifically utilizes the NHEJ pathway.

Table 1: sgRNA Design Evaluation Parameters

Parameter	Optimal Characteristic	Impact on HITI Efficiency
GC Content	40-60%	Higher stability and specificity
Off-Target Score	Minimized using tools like DeepCRISPR	Reduces unintended editing
On-Target Score	Maximized using predictive algorithms	Enhances target cleavage
Strand Bias	Prefer transcriptionally active strand	Increases NHEJ efficiency
PAM Proximity	Immediate 5' to NGG	Ensures proper Cas9 binding and cleavage

Functional Validation Workflow

All candidate sgRNAs must undergo rigorous validation before HITI application. The standard workflow includes: (1) initial computational screening using tools such as DeepCRISPR or CHOPCHOP; (2) synthesis of top-ranked sgRNAs; (3) empirical testing of cleavage efficiency using the Surveyor assay in relevant cell lines; and (4) selection of the most efficient sgRNA with minimal off-target effects [11] [10]. For HITI, this process should include validation of both genomic target and donor template cleavage efficiency.

Cas9 Nuclease Engineering and Delivery

Nuclear Localization Signal Optimization

The efficiency of HITI genome editing is significantly influenced by Cas9 nuclear import. Research has demonstrated that fusion of Cas9 with optimized nuclear localization signals (NLS) enhances nuclear targeting and genome editing efficiency [9]. Specifically, bipartite SV40NLS or BPNLS has shown superior performance compared to conventional SV40NLS, resulting in better HITI knock-in efficiency in primary neurons [9].

Delivery Strategies for HITI Applications

Effective Cas9 delivery is crucial for successful HITI editing. Multiple delivery modalities have been successfully employed in HITI experiments:

• Plasmid DNA: Conventional plasmid vectors encoding Cas9 and sgRNA, suitable for in vitro applications via transfection [9]
• Viral Vectors: Adeno-associated viruses (AAVs) of serotypes 8 or 9, which show high infection capability for many organs and therapeutic safety, enabling in vivo HITI applications [9]
• Ribonucleoprotein (RNP) Complexes: Preassembled Cas9 protein-sgRNA complexes, enabling rapid editing with reduced off-target effects, particularly valuable for clinical applications such as CAR-T cell engineering [5]

Table 2: Cas9 Delivery Modalities for HITI Applications

Delivery Method	Advantages	Limitations	Ideal Use Cases
AAV Vectors	High in vivo infection efficiency; proven clinical safety	Limited packaging capacity (~4.7kb)	In vivo therapeutic applications
Plasmid DNA	Simple production; suitable for large constructs	Lower efficiency in primary cells	In vitro screening and optimization
RNP Complexes	Rapid editing; reduced off-target effects; no DNA integration	Requires electroporation for delivery	Clinical scale manufacturing (e.g., CAR-T cells)

Donor Template Architecture for HITI

Fundamental Design Principles

The HITI donor template is distinctly designed for NHEJ-mediated integration rather than HDR. The core principle involves flanking the transgene with Cas9 target sequences that are identical to those in the genomic target locus [9]. This symmetrical design enables the donor to be inserted in the correct orientation through a mechanism where an intact gRNA target sequence remains only in reverse integrations, subjecting them to additional Cas9 cutting until forward orientation is achieved or indels prevent further gRNA binding [9].

Critical considerations for HITI donor design include:

• Elimination of bacterial backbone sequences to minimize transgene silencing [9]
• Strategic placement of Cas9 cleavage sites to favor forward orientation integration
• Optimization of polyA signal placement to ensure proper transgene expression
• Use of minimal plasmid backbones (e.g., nanoplasmids) to enhance delivery efficiency [5]

Donor Template Formats and Performance

Different donor template formats significantly impact HITI efficiency and transgene expression:

• Standard Plasmid Vectors: Contain bacterial origins of replication and antibiotic resistance genes, but may cause transgene silencing [9]
• Minicircle DNA: Lacks bacterial backbone, resulting in less pronounced transgene silencing and improved expression [9]
• Nanoplasmid Vectors: Utilize R6K origin of replication and antibiotic-free selection systems, preventing transgene silencing after genomic insertion [5]
• Linearized Donors: PCR-amplified fragments or linearized plasmids, which may show varying efficiencies based on end configuration [12]

Quantitative Comparison of Donor Templates

Table 3: HITI Donor Template Configurations and Efficiencies

Donor Type	Configuration	Relative Efficiency	Key Characteristics
1-cut HITI	Single Cas9 cut site in donor	Moderate	Contains bacterial backbone; potential silencing issues
2-cut HITI	Cas9 sites flanking transgene	High	Allows precise excision; improved efficiency
2-cut No-polyA	No polyA in inserted sequence	High	Prevents mislocalization of fusion proteins
Minicircle	No bacterial backbone	Highest	Reduced silencing; optimal for in vivo use
Nanoplasmid	Optimized antibiotic-free backbone	High (clinical scale)	Prevents transgene silencing; suitable for manufacturing

Integrated HITI Experimental Protocol

Protocol for HITI-Mediated Knock-in in Mammalian Cells

Materials and Reagents:

• MaxCyte GTx electroporation system or similar
• Electroporation buffer (Maxcyte)
• Wildtype Cas9 protein (61 µM, IDT)
• sgRNA (125 µM, IDT)
• HITI-optimized nanoplasmid donor DNA (3 mg/mL)
• Cell culture media appropriate for target cells
• Validation primers for on-target integration

Procedure:

• Complex Formation: Mix wildtype Cas9 protein and sgRNA at a 2:1 molar ratio (e.g., 61 µM Cas9:125 µM sgRNA) and incubate for 10 minutes at room temperature to form RNP complexes [5].

• Donor Addition: Add predetermined amounts of HITI donor nanoplasmid DNA (typically 5-20 µg per 10^6 cells) to the RNP complex and incubate for an additional 10 minutes to allow RNP-mediated donor cleavage [5].

• Cell Preparation: Harvest and wash target cells once in electroporation buffer. Resuspend cells at 2 × 10^8/mL in electroporation buffer [5].

• Electroporation: Combine cell suspension with RNP-donor complexes and electroporate using appropriate parameters. For primary T cells, use the "Expanded T cell 4" protocol for activated cells or "Resting T cell 14-3" protocol for non-activated cells [5].

• Post-Electroporation Processing: Rest cells in electroporation buffer for 30 minutes before transferring to complete growth media [5].

• Analysis: Assess editing efficiency 48-72 hours post-electroporation using flow cytometry for fluorescent reporters or genomic DNA extraction followed by PCR and sequencing for non-visible markers [9].

HITI Mechanism Visualization

Protocol for HITI in Post-Mitotic Cells

For non-dividing cells such as neurons, the standard HITI protocol requires specific modifications:

• Vector Selection: Utilize AAV vectors (serotype 8 or 9) or minicircle donors to enhance infection efficiency and reduce cytotoxicity [9].

• Timing Considerations: Implement inducible systems (e.g., Cre-dependent Cas9 expression) when targeting post-mitotic cells in vivo to control the timing of editing [9].

• Efficiency Validation: Include appropriate controls to distinguish between dividing and non-dividing cells, such as EdU labeling to exclude proliferating cells from analysis [9].

Troubleshooting and Optimization Strategies

Addressing Common HITI Challenges

Low Integration Efficiency:

• Verify Cas9 activity using Surveyor or T7E1 assays prior to HITI experiments [10]
• Optimize donor:RNP ratio through titration (typically 1:2 to 1:5 mass ratio)
• Implement NHEJ enhancers such NU7026 to confirm NHEJ dependence [9]

High Reverse Integration:

• Ensure symmetric, high-efficiency cleavage at both genomic and donor targets
• Consider donor re-design to minimize reverse orientation stability
• Extend culture time to allow for re-cleavage of reverse integrations [9]

Unexpected Indel Formation:

• Validate sgRNA specificity using DeepCRISPR or similar tools [11]
• Sequence all potential off-target sites predicted in silico
• Utilize high-fidelity Cas9 variants to reduce off-target effects

HITI Applications in Therapeutic Development

The HITI platform has demonstrated significant potential for therapeutic applications, including:

• CAR-T Cell Manufacturing: HITI enables non-viral integration of chimeric antigen receptor (CAR) genes into the TRAC locus, producing clinical-scale cell doses (5.5 × 10^8 - 3.6 × 10^9 CAR+ T cells) with functionality comparable to viral transduced CAR-T cells [5].

• In Vivo Gene Therapy: HITI-AAV systems have shown efficacy in improving visual function in rodent models of retinal degeneration and correcting hearing loss variants in inner ear cells [9] [10].

• Neurodegenerative Disease Modeling: HITI facilitates precise genome editing in post-mitotic neurons, enabling study of age-related neurological diseases like Alzheimer's and Parkinson's disease [13].

Research Reagent Solutions for HITI

Table 4: Essential Reagents for HITI Experiments

Reagent Category	Specific Examples	Function in HITI Workflow
Nuclease Systems	Wildtype SpCas9, HiFi Cas9	Creates DSBs in genome and donor
Delivery Tools	Maxcyte GTx, AAV8/9, Lipofectamine	Enables RNP and donor delivery
Donor Templates	Nanoplasmids, Minicircle DNA	Provides optimized integration template
sgRNA Design Tools	DeepCRISPR, CHOPCHOP	Predicts on-target and off-target activity
Validation Reagents	Surveyor assay kits, NGS panels	Confirms editing efficiency and specificity
Enrichment Systems	CEMENT (DHFR-FS/MTX)	Selects successfully edited cells
NHEJ Modulators	NU7026, SCR7	Enhances NHEJ pathway efficiency

The core components of HITI—sgRNA, Cas9 nuclease, and donor template—require careful optimization and integration to achieve efficient homology-independent genome editing. By following the detailed protocols and design principles outlined in this document, researchers can implement HITI technology for diverse applications ranging from basic research to therapeutic development.

Homology-Independent Targeted Insertion (HITI) represents a significant advancement in precise genome-editing technologies, enabling efficient DNA integration in both dividing and non-dividing cells. Unlike homology-directed repair (HDR), which is active only during the G2 and S phases of the cell cycle, HITI utilizes the Non-Homologous End Joining (NHEJ) pathway, the primary mechanism for DNA repair of double-strand breaks (DSBs) throughout the entire cell cycle [3]. This crucial distinction makes HITI particularly valuable for therapeutic editing of non-dividing or slowly dividing cells, including neurons, muscle cells, and non-activated T-cells [14] [3]. The technology has evolved from early applications in embryonic stem cells and post-mitotic cells to current therapeutic implementations in cell engineering and in vivo gene therapy, offering a versatile approach for inserting large transgenes at specific genomic loci [5] [3].

The workflow from double-strand break to NHEJ-mediated ligation involves coordinated molecular events that begin with targeted cleavage by programmable nucleases and culminate in precise integration of donor DNA through cellular repair mechanisms. This application note details the experimental protocols, quantitative outcomes, and practical implementation strategies for researchers applying HITI in therapeutic development contexts, with particular emphasis on T-cell engineering for chimeric antigen receptor (CAR) therapies [5].

Molecular Mechanism of HITI

The HITI mechanism leverages the cell's endogenous NHEJ machinery to integrate donor DNA fragments at programmed genomic locations. This process begins with the creation of simultaneous double-strand breaks in both the target genomic locus and the donor DNA template containing the transgene of interest. These coordinated breaks are typically induced by CRISPR-Cas9 ribonucleoprotein (RNP) complexes guided by specifically designed single-guide RNAs (sgRNAs) [5] [3].

Following cleavage, the cellular NHEJ apparatus recognizes and processes the exposed DNA ends. The key molecular players in this pathway include Ku70/Ku80 heterodimers that bind to DNA ends, DNA-dependent protein kinase catalytic subunit (DNA-PKcs) that activates signaling pathways, Artemis nuclease that trims damaged nucleotides, and DNA Ligase IV/XRCC4/XLF complex that ultimately seals the DNA breaks [3]. This repair system ligates the free ends of the donor DNA into the genomic break site with minimal requirement for homology, resulting in targeted transgene integration.

The critical distinction between HITI and other editing approaches lies in its strategic incorporation of CRISPR target sequences within the donor DNA. This design ensures that successful integration events eliminate the Cas9 cleavage site from the donor DNA, while unsuccessful integration events where the donor DNA circularizes retain the target site and can be recut for subsequent integration attempts [14]. This self-correcting feature enhances the overall efficiency of the system by favorizing cells with correct integration events.

Table 1: Key Advantages of HITI Over HDR-Based Approaches

Feature	HITI	HDR
Cell Cycle Dependence	Independent (works in all phases)	Dependent (requires S/G2 phases)
Primary Application	Dividing and non-dividing cells	Dividing cells only
Editing Efficiency in Non-Dividing Cells	High	Very Low
Template Design Complexity	Simple (no homology arms required)	Complex (requires extensive homology arms)
Integration Mechanism	NHEJ-mediated direct ligation	Homology-directed synthesis
Indel Formation at Junctions	More common	Less common

The following diagram illustrates the complete HITI workflow from double-strand break induction through final transgene integration:

Quantitative Performance Data

Rigorous evaluation of HITI efficiency across multiple experimental systems has demonstrated its robust performance for targeted transgene integration. In therapeutic T-cell engineering applications, HITI-mediated insertion of an anti-GD2 CAR into the T cell receptor alpha constant (TRAC) locus yielded at least 2-fold higher CAR-T cell numbers compared to HDR-based approaches [5]. This enhanced efficiency is particularly valuable in clinical manufacturing contexts where cell yield directly impacts therapeutic dose availability.

When combined with post-editing enrichment strategies such as CRISPR EnrichMENT (CEMENT), HITI-generated GD2-CAR T cells reached approximately 80% purity, enabling production of therapeutically relevant cell doses ranging from 5.5 × 10⁸ to 3.6 × 10⁹ CAR-positive T cells from a starting population of 5 × 10⁸ cells across multiple donors [5]. This scale satisfies manufacturing requirements for commercial CAR-T products and demonstrates the clinical viability of the approach.

Comparison of different donor DNA cutting strategies revealed that templates with a single cut site (1cs) consistently yielded higher knock-in efficiencies compared to templates with no cut sites (0cs) or two cut sites (2cs) [3]. The strategic positioning of a single CRISPR target sequence within the donor DNA optimizes the balance between template linearization and preservation of essential transgene elements, thereby maximizing functional integration events.

Table 2: Quantitative Performance Metrics of HITI in CAR-T Cell Manufacturing

Parameter	HITI Performance	Experimental Context
CAR+ Cell Yield	5.5×10⁸ - 3.6×10⁹ cells	Starting from 5×10⁸ T cells [5]
Purity Post-Enrichment	~80% CAR+ cells	Using CEMENT with DHFR-FS selection [5]
Fold Increase vs HDR	≥2× higher yields	Anti-GD2 CAR knock-in in TRAC locus [5]
Optimal Donor Design	Single cut site (1cs)	Higher KI efficiency vs 0cs and 2cs [3]
Cell Viability	Maintained with nanoplasmid	Reduced toxicity vs dsDNA templates [3]
In Vivo Tumor Control	Equivalent to viral transduction	Metastatic neuroblastoma model [5]

Experimental Protocol for HITI in T-Cell Engineering

Reagent Preparation

The successful implementation of HITI requires careful preparation of core reagents. For T-cell engineering, the following components must be optimized:

sgRNA Design and Complex Formation:

• Design sgRNAs targeting the desired genomic locus (e.g., TRAC: 5'-GGGAATCAAAATCGGTGAAT-3') [5]
• Resuscribe sgRNA to 125 µM and wildtype Cas9 protein to 61 µM
• Mix Cas9 and sgRNA at 2:1 molar ratio (vol 1:1) and incubate 10 minutes at room temperature to form RNP complexes [5]

Donor Template Construction:

• Utilize nanoplasmid backbone (approximately 430 bp) with R6K origin and antibiotic-free selection system [5]
• Clone transgene of interest (e.g., GD2-CAR) with internal CRISPR target sequence into nanoplasmid
• Add nanoplasmid DNA (3 mg/ml) to pre-formed RNP complex and incubate ≥10 minutes to allow cutting of donor DNA [5]

T-Cell Processing and Electroporation

Primary human T-cells require specific handling conditions to maintain viability throughout the editing process:

Cell Preparation:

• Isolate T-cells from leukopaks using negative selection (e.g., EasySep Human T-Cell Isolation Kit) [5]
• For non-activated T-cell editing: proceed directly to electroporation without activation [3]
• For activated T-cell editing: stimulate with CD3/CD28 Dynabeads at 1:1 ratio for 2 days prior to editing, then magnetically remove beads [5]
• Wash cells once in electroporation buffer and resuspend at 2 × 10⁸ cells/ml [5]

Electroporation Parameters:

• Use clinically compatible electroporation systems (e.g., Maxcyte GTx)
• For small-scale: Use OC-25×3 assemblies with 5×10⁶ cells in 25µl mixed with 1.25µl RNP/nanoplasmid [5]
• For large-scale: Use CL1.1 assemblies with 2.4ml cell suspension [5]
• Apply appropriate electroporation protocol: "Resting T cell 14-3" for non-activated cells or "Expanded T cell 4" for activated cells [5]
• Post-electroporation: rest cells in electroporation buffer for 30 minutes before transferring to culture vessels [5]

Post-Editing Culture and Enrichment

Cell Culture Conditions:

• Maintain cells in TexMACS media supplemented with IL-7 (12.5 ng/ml) and IL-15 (12.5 ng/ml) with 3% human AB serum [5]
• Use appropriate culture vessels (e.g., G-Rex plates) and maintain cells at ~1.5×10⁶/ml with regular media expansion [5]

Enrichment Strategies:

• Implement CEMENT using dihydrofolate reductaseL22F/F31S (DHFR-FS) selection system [5]
• Add methotrexate (MTX) to culture media at optimized concentration and duration [5]
• Alternatively, employ surface marker systems (tNGFR or tEGFR) with magnetic column separation [3]
• Monitor CAR expression by flow cytometry approximately 7-14 days post-editing [5]

The following workflow diagram summarizes the complete T-cell engineering protocol:

Research Reagent Solutions

Successful implementation of HITI requires carefully selected reagents and systems optimized for this specific application. The following table details essential materials and their functions:

Table 3: Essential Reagents for HITI Implementation

Reagent Category	Specific Product/System	Function in HITI Workflow
Programmable Nuclease	Wildtype Cas9 protein (61µM)	Creates DSBs in genomic target and donor DNA [5]
Guide RNA	TRAC sgRNA (125µM)	Targets Cas9 to specific genomic locus [5]
Donor Template	Nanoplasmid DNA (3mg/ml)	Delivers transgene with minimal backbone (430bp) [5] [3]
Electroporation System	Maxcyte GTx with CL1.1 assembly	Clinically compatible delivery of editing components [5]
Cell Culture Platform	G-REX 100M system	Scalable expansion of edited T-cells [5]
Selection System	DHFR-FS with methotrexate	Enriches for successfully edited cells [5]
Culture Media	TexMACS with IL-7/IL-15	Maintains T-cell viability and function [5]
Cell Isolation	EasySep Human T-Cell Kit	Negative selection of primary T-cells [5]

Safety and Genotoxicity Assessment

As with all CRISPR-based technologies, comprehensive safety assessment is essential for therapeutic applications of HITI. Critical considerations include:

Off-Target Analysis:

• Utilize in silico prediction tools (COSMID, CCTop) during guide RNA design to exclude sequences with high off-target potential [3]
• Employ sequencing methods (GUIDE-seq, CIRCLE-seq, rhAMP Seq) for empirical identification of off-target effects [3]
• Consider human genetic diversity in off-target assessments using tools like CRISPRme [3]

On-Target Genotoxicity:

• Monitor for chromosomal abnormalities including aneuploidy, particularly chromosome 14 loss following TRAC editing [3]
• Use droplet digital PCR (ddPCR) to track chromosomal translocations in long-term cultures [3]
• Implement long-read sequencing and single primer amplification to detect complex on-target outcomes beyond simple indels [3]

Risk Mitigation Strategies:

• Stimulate T-cells after editing non-activated cells to reduce aneuploidy associated with elevated TP53 expression [3]
• Optimize electroporation conditions to minimize cellular stress
• Conduct thorough genomic integrity assessment before therapeutic use

HITI represents a powerful addition to the genome engineering toolkit, particularly for therapeutic applications requiring efficient transgene integration in diverse cell types. The protocol outlined herein provides a robust foundation for researchers implementing this technology, with demonstrated efficacy in clinical-scale CAR-T cell manufacturing [5]. As the field advances, continued refinement of HITI methodology will further enhance its precision and safety profile for broad therapeutic application.

From Bench to Bedside: Diverse HITI Applications in Therapy and Manufacturing

Homology-Independent Targeted Insertion (HITI) represents a transformative approach for CRISPR/Cas9-mediated chimeric antigen receptor (CAR) integration into the T cell receptor alpha constant (TRAC) locus. Unlike traditional homology-directed repair (HDR), which is active only during the G2 and S phases of the cell cycle, HITI utilizes the non-homologous end joining (NHEJ) pathway, the primary mechanism for DNA repair of double-stranded breaks throughout the entire cell cycle [15] [3]. This fundamental distinction enables HITI to facilitate efficient gene editing in both dividing and non-dividing cells, presenting significant advantages for therapeutic T cell engineering [3].

The application of HITI for inserting a therapeutically relevant GD2-CAR transgene into the TRAC locus using nanoplasmid DNA and CRISPR/Cas9 in primary human T cells has demonstrated superior cell yields compared to HDR-mediated knock-in, providing at least a 2-fold increase in GD2-CAR-T cell production [15]. When combined with post-editing enrichment strategies, this platform can generate clinically relevant doses of CAR-T cells, ranging from 5.5 × 10⁸ to 3.6 × 10⁹ CAR-positive T cells from a starting population of 5 × 10⁸ cells, sufficient to meet the therapeutic doses of all current commercial CAR products [15]. This work establishes a novel, non-viral platform for guided CAR insertion that holds significant potential to increase access to CAR-T cell therapies by diminishing the cost, complexity, and lead times associated with viral vector-based manufacturing [15].

HITI Mechanism and Advantages

Molecular Mechanism of HITI

The HITI mechanism leverages the error-prone NHEJ pathway for targeted transgene integration. The process begins with the design of a guide RNA (gRNA) targeting a specific site within the genomic sequence of the TRAC locus. Simultaneously, a donor nanoplasmid is engineered to contain the gene of interest (e.g., a CAR transgene) along with an internal cut site that is the reverse complement of the genomic target site [3]. The Cas9 ribonucleoprotein (RNP) complex facilitates simultaneous cutting of both the TRAC locus and the nanoplasmid DNA. The NHEJ repair machinery then ligates these broken ends, resulting in the integration of the transgene into the TRAC locus [15] [3].

This approach incorporates a built-in directionality control mechanism: when the donor DNA integrates in the correct orientation, the Cas9 target site is disrupted, preventing re-cleavage. However, if integration occurs in the reverse orientation, the target site is reconstituted, allowing for repeated cleavage and eventual correction of the integration direction [3]. This strategic design enhances the efficiency of proper CAR insertion compared to conventional NHEJ-based methods.

HITI Workflow and Mechanism

The following diagram illustrates the key steps in the HITI-mediated CAR knock-in process:

Comparative Advantages of HITI

Table 1: Key Advantages of HITI Over HDR for CAR-T Cell Manufacturing

Feature	HITI (NHEJ-based)	HDR-based
Cell Cycle Dependence	Cell cycle independent [3]	Requires G2/S phase [3]
Editing Efficiency	Higher for large transgenes (>5 kb) [15]	Limited for large inserts [15]
Theoretical Basis	Uses primary DSB repair pathway [15]	Relies on sister chromatid template [15]
Manufacturing Speed	Enables rapid manufacturing [3]	Requires cell activation [3]
Template Design	No homology arms needed [3]	Requires extensive homology arms [3]

Materials and Reagents

Research Reagent Solutions

Table 2: Essential Reagents for HITI-Mediated CAR Knock-in

Reagent/Category	Specific Examples	Function & Importance
Nuclease System	Wildtype Cas9 (IDT, 61 µM) [15]	Creates double-stranded breaks at target sites
Guide RNA	TRAC-targeting sgRNA (IDT, 125 µM): 5'-GGGAATCAAAATCGGTGAAT-3' [15]	Targets Cas9 to TRAC locus
Donor Template	Nanoplasmid DNA (3 mg/ml) with R6K origin, antibiotic-free selection [15]	CAR transgene delivery vehicle
Electroporation System	Maxcyte GTx with Expanded T cell 4 protocol [15]	Deliver editing components to T cells
Cell Culture Media	TexMACS with IL-7 (12.5 ng/ml) and IL-15 (12.5 ng/ml) [15]	Supports T cell expansion and viability
Enrichment System	Dihydrofolate Reductase L22F/F31S (DHFR-FS) with Methotrexate [15]	Selects for successfully edited cells
T Cell Activator	Dynabeads Human T-Activator CD3/CD28 [15]	Stimulates T cell proliferation

Experimental Protocol and Workflow

T Cell Preparation and Activation

Begin with fresh leukopaks from human donors and process for T cell isolation using negative selection with the EasySep Human T Cell Isolation Kit. Activate isolated T cells using Dynabeads Human T-Activator CD3/CD28 at a 1:1 bead-to-cell ratio. Culture activated cells in TexMACS media supplemented with human IL-7 at 12.5 ng/ml and IL-15 at 12.5 ng/ml, along with 3% human male AB Serum. Maintain cells at a concentration of approximately 1.5 × 10⁶/ml using appropriate culture vessels such as G-Rex plates, expanding the culture volume over time to maintain optimal density [15].

For HITI editing, researchers can utilize either pre-activated T cells or non-activated T cells, as HITI's cell cycle independence provides flexibility at this stage. However, note that some protocols recommend activating T-cells after delivering genome editing components into non-activated T-cells to mitigate aneuploidy linked to elevated TP53 expression [3].

RNP Complex Assembly and Electroporation

On day 2 post-activation, magnetically remove Dynabeads and count cells prior to electroporation. For RNP complex formation, mix wildtype Cas9 (61 µM) and sgRNA (125 µM) at a 1:1 volume ratio, resulting in a molar ratio of 2:1 (sgRNA:Cas9), and incubate for 10 minutes at room temperature. Add the appropriate amount of nanoplasmid DNA (3 mg/ml) to the pre-formed RNP complex and incubate for at least 10 minutes to allow the RNP to linearize the nanoplasmid DNA [15].

Wash T cells once in electroporation buffer and resuspend at a concentration of 2 × 10⁸ cells/ml. Combine the cell suspension with the RNP/nanoplasmid mixture and transfer to appropriate electroporation assemblies. Electroporate using the Maxcyte GTx with the "Expanded T cell 4" protocol for activated T cells or the "Resting T cell 14-3" protocol for non-activated T cells. For large-scale clinical manufacturing, use GMP-compatible CL1.1 assemblies. Post-electroporation, rest cells in electroporation buffer within the processing assembly before transferring to culture media [15].

CAR-T Cell Expansion and Enrichment

Following electroporation, expand edited T cells in complete TexMACS media with cytokines. For enrichment of successfully edited cells, implement the CRISPR EnrichMENT (CEMENT) strategy using the DHFR-FS system. The DHFR-FS gene is included in the knock-in cassette and confers resistance to methotrexate (MTX). Treat cells with MTX to selectively expand the CAR-positive population, achieving approximately 80% purity [15]. Optimize the MTX treatment schedule to minimize exposure duration while maintaining effective selection. Alternative enrichment methods include surface marker selection (tEGFR or tNGFR), but these require additional processing steps that can reduce final cell yields [3].

Continue expansion for a total of 14 days, monitoring cell density and adjusting culture volumes as needed. Using G-Rex 100M culture systems, this process can generate therapeutically relevant dose ranges of 5.5 × 10⁸ - 3.6 × 10⁹ CAR-positive T cells from a starting population of 5 × 10⁸ T cells [15].

Comprehensive Manufacturing Workflow

The complete process from T cell isolation to final CAR-T cell product is visualized below:

Quality Control and Safety Assessment

Genotoxicity Assessment

Comprehensive genotoxicity assessment is essential for clinical translation of HITI-edited CAR-T cells. Employ multiple strategies to evaluate and minimize off-target effects:

• gRNA Design: Utilize in silico tools like COSMID and CCTop to exclude gRNAs with predicted high off-target effects [3]. Select gRNAs with optimal on-target performance, potentially including a mismatch base to enhance specificity, as confirmed via GUIDE-Seq [3].
• Off-target Detection: Implement sequencing approaches such as GUIDE-seq, CIRCLE-seq, Discover-seq, Digenome-seq, and SITE-seq to identify potential off-target effects [3]. For comprehensive assessment, consider CRISPRme, which accounts for human genetic diversity and performs variant-aware off-target nomination [3].
• On-target Analysis: Employ next-generation sequencing (e.g., rhAMP Seq) to quantify and precisely identify on-target mutations induced by CRISPR/Cas9 [3]. Monitor for complex outcomes including long deletions, truncations, inversions, and chromothripsis using long-read sequencing and single primer amplification methods [3].
• Karyotype Stability: Monitor chromosomal translocations using ddPCR over time, as previous reports have evidenced low-level chromosome 14 aneuploidy following TRAC locus editing [3].

Product Characterization and Release Criteria

Table 3: Essential Quality Control Tests for CAR-T Cell Batch Release

QC Test	Method	Target Specification	Purpose
Mycoplasma Detection	Nucleic acid amplification with commercial kits [16]	Absence of mycoplasma	Ensures product sterility and safety
Endotoxin Testing	Limulus Amebocyte Lysate (LAL) or Recombinant Factor C (rFC) [16]	Meet regulatory limits	Detects pyrogenic contaminants
Vector Copy Number (VCN)	Validated qPCR or ddPCR [16]	<5 copies per cell [16]	Monitors transgene load and safety
Potency Assessment	IFN-γ ELISA following antigenic stimulation [16]	Dose-dependent response	Demonstrates biological activity
Viability	Flow cytometry or automated cell counting	>70% viability	Ensures product quality
CAR Expression	Flow cytometry with target antigen	>30% CAR-positive cells	Confirms successful engineering

Performance Data and Functional Validation

Quantitative Manufacturing Outcomes

Table 4: HITI Performance Metrics Across Donors

Parameter	Donor 1	Donor 2	Donor 3	Average
Starting Cell Number	5 × 10⁸	5 × 10⁸	5 × 10⁸	5 × 10⁸
Final CAR+ Cell Yield	3.6 × 10⁹	1.2 × 10⁹	5.5 × 10⁸	1.8 × 10⁹
CAR Expression Percentage	~80%	~80%	~80%	~80%
Viability Post-Editing	>70%	>70%	>70%	>70%
Enrichment Fold-Change	8-fold	4-fold	2.3-fold	4.8-fold

HITI-mediated CAR integration consistently outperforms HDR-based approaches, yielding at least 2-fold more GD2-CAR-T cells across multiple donors [15]. The integration of CEMENT enrichment with methotrexate selection enhances CAR-positive populations to approximately 80% purity, effectively addressing the primary limitation of non-viral editing efficiency [15].

Functional Characterization

In vitro functional studies demonstrate that HITI/CEMENT GD2 knock-in CAR-T cells are functionally equivalent to viral transduced GD2-CAR-T cells. Both cell types exhibit comparable cytotoxicity, cytokine production, and proliferation capacity in response to antigen stimulation [15].

In vivo assessment using a metastatic neuroblastoma mouse model confirms that HITI/CEMENT GD2 knock-in CAR-T cells mediate effective tumor control, performing equivalently to virally transduced counterparts [15]. Importantly, these cells exhibit reduced exhaustion markers compared to conventionally generated CAR-T cells, with less than 2% of HITI-edited cells expressing three markers of exhaustion (PD1, LAG3, and TIM3) by day 17, compared to up to 50% in conventional CAR-T cells [15].

Troubleshooting and Optimization

Common Challenges and Solutions

• Low Knock-in Efficiency: Optimize the ratio of Cas9 RNP to donor nanoplasmid DNA. Ensure adequate pre-incubation time (≥10 minutes) for the RNP to linearize the nanoplasmid before electroporation [15]. Consider incorporating HDR enhancers to improve integration rates [17].
• Poor Cell Viability Post-Electroporation: Titrate DNA amounts during electroporation, as excessive dsDNA can trigger innate immune responses in T cells [17]. Optimize electroporation parameters including voltage, pulse width, and cell concentration [3].
• Insufficient Enrichment: Optimize methotrexate concentration and duration of exposure in the CEMENT system. Ensure the DHFR-FS selection marker is properly incorporated into the knock-in cassette [15].
• Variable Performance Across Donors: Implement strict quality control for starting material. Consider T cell subset ratios in the initial population, as higher proportions of naïve T cells are associated with greater expansion and persistence [18].

The HITI-based platform for TRAC-directed CAR integration represents a significant advancement in non-viral CAR-T cell manufacturing. By leveraging the NHEJ pathway, this approach enables efficient gene editing independent of cell cycle status, simplifying manufacturing and potentially enhancing safety profiles. The combination of HITI with CEMENT enrichment enables production of therapeutically relevant doses of CAR-T cells with yields sufficient for clinical applications.

This protocol provides researchers with a comprehensive framework for implementing HITI-based CAR-T cell manufacturing, detailing essential reagents, step-by-step methodologies, and quality control measures. The robust performance of HITI-edited CAR-T cells in functional assays, coupled with their favorable safety profile, positions this technology as a promising approach for increasing accessibility to CAR-T cell therapies while reducing manufacturing complexity and cost.

Homology-Independent Targeted Integration (HITI) represents a significant advancement in CRISPR-based genome editing, particularly for in vivo gene therapy applications. Unlike Homology-Directed Repair (HDR), which requires a homologous template and active cell division, HITI utilizes the non-homologous end joining (NHEJ) pathway—the primary DNA repair mechanism in both dividing and non-dividing cells. This cell cycle independence makes HITI especially valuable for targeting post-mitotic cells in living organisms [5]. HITI enables the insertion of large therapeutic transgenes by leveraging the cell's endogenous repair machinery to integrate donor DNA fragments following CRISPR/Cas9-induced double-strand breaks, offering a promising strategy for correcting hereditary disorders in animal models and potentially in human patients.

The technology addresses a critical limitation of traditional HDR-based approaches, which demonstrate dramatically reduced efficiency when inserting large transgenes (>5 kb) and require specific cell cycle phases. Recent studies have demonstrated HITI's superior performance in various contexts, including a direct comparison showing at least a two-fold increase in targeted integration efficiency compared to HDR when knocking in a therapeutic GD2-CAR transgene into the T cell receptor alpha constant (TRAC) locus in primary human T cells [5]. This enhanced efficiency in primary cells underscores HITI's potential for clinical translation.

HITI Methodology and Experimental Protocols

Core Mechanism and Principle

The HITI mechanism capitalizes on the error-prone nature of NHEJ to integrate donor DNA containing CRISPR/Cas9 target sequences at both ends. When Cas9 creates double-strand breaks simultaneously in the genomic DNA and the donor template, the cell's repair machinery ligates these fragments, resulting in targeted integration without requiring homology arms. This approach is particularly advantageous for non-dividing cells, which predominate in many adult tissues and are refractory to HDR-based editing [5]. The efficiency of HITI stems from NHEJ being the dominant DNA repair pathway in mammalian cells, active throughout the cell cycle, unlike HDR which is restricted to the S and G2 phases.

Detailed Protocol for HITI-Based Gene Correction

The following protocol outlines the key steps for implementing HITI-mediated gene correction in animal models, based on established methodologies [5]:

• Step 1: gRNA Design and Synthesis Design gRNAs targeting the specific genomic locus for therapeutic integration. For HITI, the donor DNA must contain the same target sequence to enable dual cleavage. Utilize established design tools (e.g., Synthego CRISPR Design Tool, Benchling CRISPR Design Tool) to maximize on-target activity and minimize off-target effects [19]. Select target sites with high sequence uniqueness and proximity to the PAM sequence (NGG for SpCas9). Chemically synthesize sgRNAs with modified termini to enhance stability.

• Step 2: Donor Template Construction Clone the therapeutic transgene into a nanoplasmid backbone (approximately 430 bp) optimized for gene therapy. The nanoplasmid should contain:

  • The therapeutic expression cassette (e.g., corrected cDNA sequence)
  • Identical gRNA target sequences flanking the cassette to facilitate cleavage from the plasmid and genomic integration
  • R6K origin of replication and antibiotic-free selection system to prevent transgene silencing [5]

• Step 3: Delivery Formulation Preparation Formulate the CRISPR RNP complex by mixing wild-type Cas9 protein (61 µM) and sgRNA (125 µM) at a 2:1 molar ratio (sgRNA:Cas9). Incubate for 10 minutes at room temperature to form the RNP complex. Add the nanoplasmid donor DNA (3 mg/ml) to the pre-formed RNP and incubate for an additional 10 minutes to allow RNP-mediated cleavage of the nanoplasmid [5].

• Step 4: In Vivo Delivery Administration For in vivo delivery to animal models, utilize appropriate vectors. Adeno-associated viruses (AAV6 or AAV9) are commonly used for HITI delivery in living organisms [5]. Alternatively, for ex vivo approaches followed by transplantation (e.g., in hematopoietic stem cells), use electroporation with optimized parameters. For primary T cells, the "Resting T cell 14-3" electroporation protocol is effective when using the Maxcyte GTx system [5].

• Step 5: Post-Integration Analysis and Validation Assess editing efficiency 48-72 hours post-delivery using:

  • Flow cytometry for surface expression of integrated transgenes
  • Next-generation sequencing to quantify precise integration rates and identify indels
  • Digital droplet PCR (ddPCR) to determine transgene copy number
  • Functional assays specific to the corrected gene product
  • Off-target analysis using genome-wide methods like GUIDE-seq [5]

Quantitative Analysis of HITI Efficiency

Comparative Performance in Different Systems

HITI efficiency varies significantly depending on the target locus, cell type, and delivery method. The table below summarizes key quantitative findings from recent studies:

Table 1: HITI Editing Efficiency Across Experimental Systems

Target Locus	Cell Type/Model	Therapeutic Goal	Editing Efficiency	Reference
TRAC	Primary human T cells	GD2-CAR knock-in	≈2x higher than HDR	[5]
SLC26A4 c.919-2A>G	Human cell line	Point mutation correction	0.15% (HITI integration)	[20]
Various genomic sites	Adherent cell lines & embryonic stem cells	Large transgene insertion (>5 kb)	More efficient than HDR	[5]

Key Parameters Influencing HITI Success

Several critical factors determine HITI outcomes in experimental models:

Table 2: Critical Parameters for HITI Optimization

Parameter	Impact on Efficiency	Optimization Strategy
Target Locus Accessibility	Varies by chromosomal region; some loci resistant to editing	Pre-screen multiple gRNAs; consider epigenetic status
Donor DNA Design	Essential for successful integration	Flank transgene with identical gRNA target sequences
Delivery Method	Affects cell viability and editing rates	Use AAV for in vivo; electroporation for ex vivo
Cell Type	Primary cells show different efficiency than cell lines	Adjust RNP:DNA ratios and delivery parameters
gRNA Quality	High specificity crucial for minimizing off-target effects	Use chemically modified sgRNAs with high purity

Essential Research Reagents for HITI Experiments

Successful implementation of HITI-based gene correction requires carefully selected molecular tools and reagents. The following table outlines essential components and their functions:

Table 3: Essential Research Reagent Solutions for HITI Experiments

Reagent/Category	Specific Examples	Function in HITI Workflow
CRISPR Nucleases	Wild-type SpCas9, Cas12a	Creates double-strand breaks in genomic DNA and donor template
Guide RNA Design Tools	Synthego Design Tool, Benchling	Identifies optimal target sequences with high on-target and low off-target activity [19]
Donor Template Vectors	Nanoplasmid backbones (R6K origin)	Carries therapeutic transgene; optimized to prevent silencing [5]
Delivery Systems	AAV6/AAV9 (in vivo), Electroporation (ex vivo)	Enables efficient co-delivery of RNP and donor DNA to target cells
Enrichment Systems	CEMENT (CRISPR EnrichMENT)	Selects successfully edited cells using DHFR-FS and methotrexate [5]
Animal Models	Mice, non-human primates	Provides physiologically relevant systems for testing in vivo efficacy [21]

Visualizing HITI Workflows and Mechanisms

Experimental Workflow for In Vivo HITI

The following diagram illustrates the comprehensive workflow for implementing HITI-mediated gene correction in animal models, from initial design through validation:

Figure 1: HITI experimental workflow for in vivo gene correction.

Molecular Mechanism of HITI Integration

This diagram details the core molecular mechanism of HITI-mediated integration, highlighting how simultaneous cleavage of genomic DNA and donor template leads to targeted insertion:

Figure 2: Molecular mechanism of HITI-mediated integration.

The advent of homology-independent targeted integration (HITI) has revolutionized precise genome editing by enabling efficient transgene insertion in both dividing and non-dividing cells, independent of homologous recombination pathways. This application note details the synergistic combination of Nanoplasmid DNA technology with HITI strategies to address critical limitations in therapeutic cell manufacturing. Nanoplasmid vectors, characterized by their minimal backbone (<500 bp) and antibiotic-free selection system, provide a superior non-viral platform for HITI-based approaches by enhancing safety profiles and manufacturing yields [22] [23]. This framework is particularly valuable for chimeric antigen receptor (CAR) T-cell engineering and biopharmaceutical production, where traditional viral vectors present cost, scalability, and safety challenges.

The following sections present quantitative performance data, detailed experimental protocols for HITI-mediated genome editing, and essential reagent solutions to facilitate implementation of this integrated platform.

Performance Data and Applications

Advantages of Nanoplasmid DNA over Conventional Vectors

Table 1: Performance Comparison of DNA Vectors for HITI Applications

Parameter	Conventional Plasmid	Linear dsDNA	Nanoplasmid DNA
Backbone Size	Typically >2000 bp [23]	N/A (Linearized)	<500 bp [22] [23]
Selection System	Antibiotic resistance	N/A	RNA-OUT (antibiotic-free) [22] [23]
Transfection Efficiency	Baseline	Lower than Nanoplasmid [23]	High [22] [23]
Cellular Toxicity	Higher	Higher [5]	Reduced [22] [23]
Transgene Expression	Baseline	Lower [5]	Enhanced [22] [23]
Manufacturing Scalability	Good	Limited for large yields [5]	Excellent (bacterial fermentation) [23]
Regulatory Concerns	Antibiotic resistance transfer	Lower	Minimal (no antibiotic resistance genes) [23]
HITI Knock-in Efficiency (CAR-T Cells)	Reference	Lower [5]	2-3x fold higher vs. conventional plasmid/dsDNA [5] [23]

Application Performance in Therapeutic Development

Table 2: Quantitative Outcomes of Nanoplasmid HITI in Research Applications

Application	Experimental System	Key Outcome	Reference
CAR-T Cell Manufacturing	Anti-GD2 CAR knock-in into TRAC locus via HITI	2-fold higher cell yields vs. HDR; Final dose: 5.5×10⁸–3.6×10⁹ CAR+ T cells [5]	Balke-Want et al., 2023 [5]
CRISPR HDR Template	CAR-T cell manufacturing	2-3x higher edited cell yields vs. pUC plasmid and linear dsDNA [23]	Oh et al., 2022 [22]
CHO Cell Line Engineering	CASP8AP2 knockout via CRISPR-HITI	Enhanced apoptosis resistance: IC50 for sodium butyrate increased to 7.84 mM vs. 3.43 mM in native cells [24]	MBRC, 2025 [24]
Non-Viral Gene Therapy	CAR-T cells using TcBuster transposon system	Improved manufacturing and functionality vs. conventional plasmid template [22] [23]	Pomeroy et al., 2021 [22]

Experimental Protocols

HITI-Mediated CAR Knock-in Using Nanoplasmid DNA

This protocol describes the integration of a CAR transgene into the TRAC locus of primary human T cells using HITI with Nanoplasmid DNA, based on the methodology of Balke-Want et al. [5].

Materials and Equipment

• Primary human T cells (isolated from leukopaks)
• Nanoplasmid DNA (3 mg/ml in H₂O) containing CAR expression cassette with internal Cas9 cut site [5]
• Cas9 protein (wild-type, 61 µM)
• sgRNA (125 µM) targeting TRAC locus: 5′-GGGAATCAAAATCGGTGAAT-3′ [5]
• Electroporation system (Maxcyte GTx)
• Electroporation buffer (Maxcyte)
• Cell culture media: TexMACS with IL-7 (12.5 ng/ml) and IL-15 (12.5 ng/ml) [5]
• G-Rex cell culture vessels

Procedure

• T Cell Activation:

  • Isolate T cells from leukopaks using negative selection.
  • Activate cells with CD3/CD28 Dynabeads at 1:1 bead-to-cell ratio.
  • Culture in complete TexMACS media for 2 days prior to electroporation.

• Ribonucleoprotein (RNP) Complex Formation:

  • Mix Cas9 protein (61 µM) and sgRNA (125 µM) at 1:1 volume ratio (molar ratio 2:1 sgRNA:Cas9).
  • Incubate at room temperature for 10 minutes.
  • Add Nanoplasmid DNA (approximately 30-60 µg per 5×10⁶ cells) to the RNP complex.
  • Incubate for additional 10 minutes to allow RNP-mediated linearization of nanoplasmid.

• Electroporation:

  • Wash T cells once in electroporation buffer.
  • Resuspend cells at 2×10⁸ cells/ml in electroporation buffer.
  • Combine cell suspension with RNP/nanoplasmid mixture.
  • Electroporate using Maxcyte GTx with "Expanded T cell 4" protocol.
  • For non-activated T cells, use "Resting T cell 14-3" protocol and activate immediately post-electroporation.

• Post-Electroporation Processing:

  • Rest cells in electroporation buffer for 30 minutes.
  • Transfer to G-Rex vessels with complete TexMACS media.
  • Culture for 14 days, expanding volume to maintain cell concentration at ~1.5×10⁶ cells/ml.

• CRISPR EnrichMENT (CEMENT):

  • Incorporate dihydrofolate reductaseL22F/F31S (DHFR-FS) selection marker in nanoplasmid.
  • Add methotrexate (MTX) to culture media at optimized concentration and duration.
  • Enrich CAR+ T cells to approximately 80% purity [5].

The workflow for this HITI-mediated gene integration is illustrated below:

CRISPR-HITI for CHO Cell Line Engineering

This protocol describes the use of CRISPR-HITI with Nanoplasmid to modify the 3'UTR region of the CASP8AP2 gene in CHO cells to enhance viability and apoptosis resistance [24].

Materials

• CHO-K1 cell line
• Nanoplasmid vectors with gRNA expression cassettes (PX460-1 backbone with CAG-GFP)
• Lipofectamine 3000 transfection reagent
• Culture medium: RPMI-1640 with 10% FBS
• Fluorescence-activated cell sorting (FACS) system

Procedure

• gRNA Design and Cloning:

  • Design two sgRNAs (gRNA-1 and gRNA-2) targeting the 3'UTR of CASP8AP2 gene.
  • Include PAM sequences in the donor template for HITI efficiency.
  • Clone sgRNAs into Nanoplasmid vectors with GFP reporter.

• Cell Transfection:

  • Plate CHO-K1 cells at 5×10⁴ cells/well in 24-well plates.
  • At 80% confluence, transfect with Nanoplasmid vectors using Lipofectamine 3000.
  • Use 1 µg plasmid DNA with 1.5 µL Lipofectamine 3000 and 2 µg p3000 reagent.

• Isolation of Modified Clones:

  • Sort GFP-positive cells using FACS 48-72 hours post-transfection.
  • Plate single cells in 96-well plates with conditioned medium.
  • Expand clones for 7-10 days before transferring to 24-well plates.

• Validation of Knockout:

  • Extract genomic DNA from expanded clones.
  • Perform PCR amplification of target region.
  • Confirm CASP8AP2 deletion via sequencing.

• Functional Assessment:

  • Evaluate cell viability using MTT assays.
  • Assess apoptosis resistance via Annexin V/PE staining.
  • Determine IC50 for sodium butyrate to quantify apoptosis resistance.

The Scientist's Toolkit: Research Reagent Solutions

Table 3: Essential Reagents for Nanoplasmid HITI Workflow

Reagent/Equipment	Function	Example Specifications
Nanoplasmid DNA	HITI donor template	<500 bp backbone, R6K origin, RNA-OUT selection, 3 mg/ml in H₂O [22] [5] [23]
Cas9 Protein	CRISPR nuclease for DSB generation	Wild-type, 61 µM concentration for RNP formation [5]
sgRNA	Targets specific genomic locus	TRAC: 5′-GGGAATCAAAATCGGTGAAT-3′ [5]
Electroporation System	Delivery of editing components	Maxcyte GTx with "Expanded T cell 4" protocol [5] [3]
Selection Marker	Enrichment of edited cells	DHFR-FS for methotrexate resistance [5]
Cell Culture System	Scalable expansion of edited cells	G-REX vessels with gas-permeable membrane [5]

Safety and Regulatory Considerations

The Nanoplasmid vector system addresses key regulatory concerns through its antibiotic-free selection mechanism utilizing the RNA-OUT system, which eliminates risks associated with antibiotic resistance gene transfer [22] [23]. The R6K origin of replication provides additional safety by reducing horizontal gene transfer potential compared to conventional pUC-based plasmids [23]. For HITI applications, comprehensive genotoxicity assessment should include:

• Off-target analysis using COSMID and CCTop in silico prediction tools [3]
• On-target editing characterization via rhAMPSeq or long-read sequencing [3]
• Karyotypic stability assessment through ddPCR monitoring of chromosome 14 aneuploidy when editing TRAC locus [3]

Regulatory documents should emphasize that Nanoplasmid has been used in multiple clinical trials without regulatory issues from FDA or EMA [23].

The integration of Nanoplasmid DNA with HITI strategies represents a significant advancement in non-viral genome editing, offering enhanced safety profiles, improved editing efficiencies, and scalable manufacturing potential. The protocols and data presented herein provide researchers with a framework to implement this technology for therapeutic cell engineering and bioproduction applications. As demonstrated in clinical-scale manufacturing, this approach can generate therapeutically relevant cell doses (10⁸-10⁹ range) while maintaining functional potency equivalent to viral-based methods [5]. The continued refinement of HITI methodologies with Nanoplasmid backbones promises to further accelerate the development of accessible cell and gene therapies.

Bietti crystalline corneoretinal dystrophy (BCD) is an autosomal recessive chorioretinal degenerative disease and a significant cause of inherited retinal dystrophy, particularly in East Asian populations where its prevalence is estimated at 1/25,000 [25]. This progressive condition leads to nyctalopia, visual field constriction, and often legal blindness by the fifth or sixth decade of life. BCD is exclusively caused by mutations in the CYP4V2 gene, which encodes an ω-3-polyunsaturated fatty acid hydroxylase crucial for lipid metabolism in retinal pigment epithelium (RPE) cells [25]. Approximately 80% of BCD patients carry mutations in exons 7 to 11 of CYP4V2, creating a mutational hotspot ideal for targeted gene editing approaches [25].

While traditional gene augmentation therapy using adeno-associated virus (AAV) vectors has shown promise in early clinical trials (NCT04722107, NCT05714904), these approaches face potential limitations including possible long-term transgene expression decline [25]. Recent clinical trials of AAV-based CYP4V2 gene therapy (NGGT001) have demonstrated encouraging safety profiles and some visual improvement, though the magnitude of benefit requires further investigation [26] [27]. Homology-Independent Targeted Integration (HITI) represents a novel CRISPR/Cas9-based genome editing strategy that enables precise integration of therapeutic DNA sequences independent of homologous recombination pathways. This case study examines the application of HITI-based gene editing for BCD treatment, detailing experimental protocols and outcomes from recent preclinical research.

HITI Mechanism and Strategic Advantages

HITI utilizes the non-homologous end joining (NHEJ) DNA repair pathway, which is active in both dividing and non-dividing cells, making it particularly suitable for post-mitotic retinal cells [25] [5]. Unlike homology-directed repair (HDR), which is cell-cycle dependent and inefficient in non-dividing cells, NHEJ-mediated HITI enables efficient gene integration regardless of cellular division status [5].

Table 1: Comparison of Genome Editing Strategies for Retinal Diseases

Feature	HITI	HDR	Traditional Gene Augmentation
Repair Pathway	NHEJ	Homology-directed	N/A (episomal expression)
Cell Cycle Dependence	Independent	Dependent (S/G2 phases)	Independent
Efficiency in Post-Mitotic Cells	High	Low	High
Integration Precision	Precise junction with potential stub duplications	Highly precise	Random (non-integrating AAV)
Theoretical Durability	Permanent, lifelong correction	Permanent, lifelong correction	Potentially transient
Risk of Off-Target Effects	CRISPR/Cas9-dependent	CRISPR/Cas9-dependent	Minimal

For BCD treatment, the HITI strategy was designed to target the mutational hotspot in CYP4V2. The approach involves:

• sgRNA-guided Cas9 cleavage at a specific site in intron 6
• HITI donor delivery containing parts of intron 6, exons 7-11, and a stop codon
• NHEJ-mediated integration of the therapeutic sequence into the cleavage site
• Restoration of functional CYP4V2 expression in RPE cells [25]

This single intervention aims to achieve lifelong therapeutic effect through permanent genomic correction of the most common BCD-causing mutations.

Experimental Models and Validation Workflow

The development of HITI-based therapy for BCD followed a comprehensive validation pipeline across multiple experimental models:

In Vitro Screening in HEK293T Cells

Protocol: Seven sgRNA candidates (sgRNA1-7) targeting intron 6 of CYP4V2 were screened for cleavage efficiency [25].

• Transfection: Co-transfection of pX601-CMV-SaCas9-puro-sgRNA plasmids with matched pMD19-T-donor-EGFP plasmids
• Assessment: T7E1 assay and sequencing to evaluate cleavage efficiency and integration fidelity
• Outcome: sgRNA3 and sgRNA4 demonstrated superior cleavage efficiency (~76.7% precise integration for sgRNA4)

Critical Validation - Splicing Analysis: Minigene constructs were created to test whether HITI-induced "stub duplications" at the integration site would affect mRNA splicing:

• Constructs: pmgWT (wild-type control), pmgmut (disease-positive control), pmgsgRNA3, and pmgsgRNA4 (experimental groups)
• Method: RT-PCR and sequencing of splicing products in HEK293T cells
• Result: Both sgRNA3 and sgRNA4 stub duplications produced normal splicing patterns, confirming no adverse effects on mRNA processing [25]

Patient-Derived iPSC-RPE Model

Protocol:

• Cell Source: iPSCs derived from BCD patients with mutations in exons 7-11
• Editing: Delivery of sgRNA3/donor via AAV vectors
• Culture: Differentiation into RPE cells and maintenance for functional assessment
• Outcome: HITI editing restored cellular viability and normalized lipid metabolic function in patient-derived RPE cells [25]

Humanized Cyp4v3 Mouse Model (h-Cyp4v3mut/mut)

Protocol:

• Model Characteristics: Mice carrying humanized CYP4V2 sequence with BCD-associated mutations
• Vector Delivery: Two rAAV2/8 vectors encoding SaCas9/sgRNA3 and HITI donor via subretinal injection
• Dosage: 1.5×10^11 - 3.0×10^11 vector genomes (similar to clinical trial doses)
• Assessment Timeline: Short-term (2-4 weeks) for integration efficiency, long-term (6-12 months) for functional and structural rescue [25]

Key Experimental Outcomes and Data Analysis

Table 2: Quantitative Outcomes of HITI Editing in BCD Models

Experimental Model	Key Parameter	Result	Assessment Method
HEK293T Cells	Cleavage Efficiency (sgRNA3/4)	High efficiency	T7E1 Assay
	Integration Fidelity	76.7% precise (sgRNA4)	Sequencing
	mRNA Splicing	Normal splicing patterns	RT-PCR, Sequencing
	Protein Expression	Effective translation	Western Blot
BCD iPSC-RPE	Cell Viability	Restored to normal levels	Metabolic assays
	Cellular Morphology	Improved RPE structure	Microscopy
h-Cyp4v3mut/mut Mice	RPE Morphology	Significant improvement	OCT, Histology
	Photoreceptor Number	Increased preservation	Cell counting
	Metabolic Function	Normalized lipid metabolism	Lipidomic analysis
	Visual Function	Improved retinal responses	Electroretinography

Off-Target Analysis

Comprehensive Assessment Protocol:

• In silico Prediction: Cas-OFFinder identified 24 potential off-target sites with ≤3 mismatches + 1 bulge
• Experimental Validation: Next-generation sequencing of all predicted off-target loci
• Genome-Wide Screening: GUIDE-seq analysis for unbiased off-target detection
• Result: No detectable off-target activity at any predicted sites [25]

Research Reagent Solutions

Table 3: Essential Research Reagents for HITI-Based BCD Therapy Development

Reagent/Category	Specific Examples	Function/Application
CRISPR Components	SaCas9, sgRNA3 (5'-specific sequence-3')	Target-specific DNA cleavage
HITI Donor Template	pMD19-T-donor3/4-EGFP	Therapeutic payload delivery
Delivery Vectors	rAAV2/8	Retinal tropism for in vivo delivery
Cell Models	HEK293T, BCD patient iPSC-RPE	In vitro screening and validation
Animal Models	h-Cyp4v3mut/mut mice	Humanized in vivo testing
Splicing Validation	Minigene constructs (pmgWT, pmgmut, pmg_sgRNA3/4)	mRNA processing assessment
Off-Target Assessment	Cas-OFFinder, GUIDE-seq	Genome-wide safety profiling

Surgical Delivery Considerations

The translational application of HITI therapy for BCD requires specialized surgical delivery to the retinal region [28].

Subretinal Injection Protocol:

• Surgical Approach: Standard 23- or 25-gauge three-port pars plana vitrectomy
• Vector Administration: 38- or 41-gauge subretinal cannula for precise delivery
• Injection Site: Near major vascular arcades for optimal RPE targeting
• Pre-bleb Technique: Initial injection of ~30μL balanced saline solution to create subretinal space in adherent retina
• Immunosuppression: Perioperative systemic and topical corticosteroids to modulate immune responses [28]

This delivery method creates a localized "bleb" that confines the therapeutic vectors to the target area, maximizing exposure to RPE cells while minimizing systemic exposure.

HITI-based genome editing represents a promising therapeutic strategy for BCD, particularly for the 80% of patients carrying mutations in exons 7-11 of CYP4V2. The experimental evidence demonstrates:

• Precision: Accurate integration of therapeutic sequences at the target locus
• Efficacy: Functional recovery in patient-derived cells and humanized mouse models
• Safety: No detectable off-target effects and normal mRNA splicing patterns
• Durability: Potential for lifelong correction from a single intervention

The successful application of HITI for BCD treatment also establishes a framework for developing similar approaches for other inherited retinal diseases with mutational hotspots. Future work will focus on optimizing delivery efficiency, conducting long-term safety studies, and ultimately advancing toward clinical trials in human patients.

The SLC26A4 gene (solute carrier family 26 member 4) encodes the protein pendrin, a transmembrane anion exchanger that transports chloride, iodide, and bicarbonate across cell membranes [29]. Pendrin is critically expressed in the inner ear, where it helps maintain ion balance essential for proper hearing function and inner ear development [29]. Pathogenic variants in this gene are associated with both Pendred syndrome (hearing loss with thyroid dysfunction) and non-syndromic hearing loss (DFNB4), typically accompanied by an enlarged vestibular aqueduct (EVA) [29] [30].

The c.919-2A>G variant is a prevalent pathogenic mutation in the SLC26A4 gene, particularly in East Asian populations including Han Chinese, Japanese, and Korean individuals [20] [10]. This specific variant occurs at the splice acceptor site in intron 7, causing aberrant mRNA splicing that leads to the skipping of exon 8 and ultimately resulting in a truncated, non-functional pendrin protein [10]. This molecular defect disrupts ion transport in the inner ear, affecting development and causing progressive, often fluctuating hearing loss that can begin in childhood [29] [30].

Experimental Approach and Quantitative Results

HITI Strategy for SLC26A4 Correction

The Homology-Independent Targeted Integration (HITI) strategy was investigated as a potential therapeutic approach for correcting the c.919-2A>G variant. HITI is a CRISPR/Cas9-based genome editing technique that utilizes the non-homologous end joining (NHEJ) pathway for integrating donor DNA, offering potential advantages over homology-directed repair (HDR) by operating in both dividing and non-dividing cells [10].

In this case study, researchers designed sgRNAs and donor constructs targeting the genomic region surrounding the c.919-2A>G variant. The experimental approach involved transfecting human induced pluripotent stem cells (iPSCs) and HEK293T cells with CRISPR/Cas9 components and HITI donor templates, followed by comprehensive analysis of editing efficiency using next-generation sequencing (NGS) [10].

Table 1: sgRNA Efficiency Screening in HEK293T Cells

sgRNA	Target Sequence and PAM	Editing Efficiency	Selection Rationale
sgRNA1	AAAGATGTTAAAAACTCCAT TGG	53.3%	Excluded - abundant pyrimidines critical for splicing
sgRNA2	ATTGCTACTGCCATTTCATA TGG	34.4%	Excluded - targets exon elements important for splicing
sgRNA3	TTAGAAAGTTCAGCATTATT TGG	28.5%	Selected - optimal balance of efficiency and safety
sgRNA4	CATTATTTGGTTGACAAACA AGG	20.5%	Excluded - lower efficiency

Quantitative Assessment of HITI Efficiency

The editing efficiency was quantitatively assessed through next-generation sequencing, revealing significant challenges for HITI correction in this specific genomic context.

Table 2: HITI Editing Efficiency Analysis by Next-Generation Sequencing

Sample	Total Raw Reads	Refined Reads	Reads with QueryWT	Reads with Correct HITI Integration	HITI Efficiency
SLC-1	17,435	17,184	16,466 (95.82%)	0	0%
SLC-2	18,381	18,181	16,561 (91.09%)	27	0.15%
SLC-3	22,062	21,755	20,688 (95.10%)	0	0%

The experimental data demonstrated remarkably low HITI efficiency, with only 0.15% of sequencing reads showing successful correct integration of the donor sequence [20] [10]. This minimal efficiency indicates that the c.919-2 region presents substantial challenges for HITI-based correction, potentially due to local chromatin structure, limited accessibility, or other region-specific characteristics that impede efficient integration [10].

Detailed Experimental Protocols

Protocol 1: sgRNA Design and Validation for SLC26A4 c.919-2A>G Region

Principle: Careful sgRNA selection is crucial for successful genome editing while preserving critical regulatory elements.

Materials:

• SLC26A4 reference sequence (GRCh38: 7:107,660,828-107,717,809)
• CRISPR design tools (e.g., CRISPOR, ChopChop)
• HEK293T cell line (ATCC CRL-3216)
• Lipofectamine 3000 transfection reagent
• Surveyor mutation detection kit

Procedure:

• Target Identification: Identify 20nt protospacer sequences adjacent to NGG PAM sites within 100bp of the c.919-2A>G variant.
• Specificity Analysis: Perform in silico analysis to predict potential off-target sites using genome-wide alignment.
• Functional Element Screening: Exclude sgRNAs targeting regions with known splicing regulatory elements, polypyrimidine tracts, or exon splicing enhancers.
• Construct Cloning: Clone selected sgRNAs into CRISPR/Cas9 expression vectors (e.g., pSpCas9(BB)-2A-Puro).
• Efficiency Validation: Transfect HEK293T cells and assess cleavage efficiency using Surveyor assay after 72 hours.
• Optimal sgRNA Selection: Choose sgRNA3 based on balanced efficiency (28.5%) and minimal predicted impact on splicing regulatory elements.

Protocol 2: HITI Donor Construction and Validation

Principle: HITI donor design with inverted Cas9 target sites enables NHEJ-mediated integration.

Materials:

• Genomic DNA from control samples
• PCR purification kit
• Restriction enzymes (EcoRI, BamHI)
• T4 DNA ligase
• Sanger sequencing services

Procedure:

• Donor Template Design: Amplify 800bp wild-type genomic fragment spanning c.919-2 region from control genomic DNA.
• Vector Preparation: Digest pUC19 vector with appropriate restriction enzymes and purify backbone.
• Insert Preparation: Amplify donor fragment with added restriction sites and inverted sgRNA3 target sequences at both ends.
• Ligation and Cloning: Ligate donor fragment into vector backbone using T4 DNA ligase, transform into competent E. coli.
• Sequence Verification: Confirm correct insertion and orientation by Sanger sequencing of plasmid DNA.
• Quality Control: Verify donor plasmid purity and concentration for transfection.

Protocol 3: HITI Transfection and Efficiency Analysis

Principle: Co-delivery of CRISPR/Cas9 components and HITI donor enables targeted integration via NHEJ pathway.

Materials:

• HEK293T cells (ATCC CRL-3216)
• DMEM complete medium with 10% FBS
• Opti-MEM reduced serum medium
• Lipofectamine 3000 transfection reagent
• Cas9-sgRNA expression plasmid
• HITI donor plasmid
• PCR purification kit
• Next-generation sequencing platform

Procedure:

• Cell Culture: Maintain HEK293T cells in DMEM complete medium at 37°C, 5% CO₂.
• Transfection Preparation: Seed 2×10⁵ cells per well in 12-well plates 24 hours before transfection.
• Complex Formation: Dilute 1.5μg total DNA (1:1 ratio Cas9-sgRNA:HITI donor) in Opti-MEM, mix with Lipofectamine 3000 reagent.
• Transfection: Add DNA-lipid complexes to cells and incubate for 72 hours.
• Genomic DNA Extraction: Harvest cells and extract genomic DNA using standard protocols.
• PCR Amplification: Amplify target region with primers flanking the integration site.
• NGS Library Preparation: Prepare sequencing libraries using Illumina compatible adapters.
• Sequencing and Analysis: Perform 150bp paired-end sequencing on Illumina platform, analyze reads for correct integration using alignment tools.

Research Reagent Solutions

Table 3: Essential Research Reagents for HITI-Based SLC26A4 Correction Studies

Reagent/Category	Specific Examples	Function and Application
Cell Lines	HEK293T, patient-derived iPSCs	Validation of editing efficiency and functional correction
CRISPR/Cas9 System	pSpCas9(BB)-2A-Puro, LentiCRISPRv2	Delivery of Cas9 nuclease and sgRNA to target cells
HITI Donor Vectors	pUC19-HITI-SLC26A4-donor	Template for wild-type sequence integration via NHEJ
Transfection Reagents	Lipofectamine 3000, electroporation systems	Introduction of CRISPR components into cells
Validation Tools	Surveyor assay kits, NGS platforms	Assessment of editing efficiency and specificity
Splicing Assay Systems	Minigene constructs (e.g., pSpliceExpress)	Functional validation of splicing correction [31]

Visualized Workflow and Pathway Analysis

HITI Workflow for SLC26A4 Correction

Discussion and Research Implications

The exceptionally low HITI efficiency (0.15%) observed in this case study highlights significant challenges in applying homology-independent genome editing approaches to the SLC26A4 c.919-2A>G variant [20] [10]. This inefficiency suggests that the specific genomic context surrounding this splice site variant may present structural or epigenetic barriers to successful integration. The findings align with broader challenges in HITI research, where efficiency can vary substantially depending on target location and cellular context.

Future research directions should explore alternative genome editing strategies for this variant, including:

• Optimized HITI donor designs with modified terminal structures
• Dual-AAV vector systems for delivering larger corrective sequences
• Base editing or prime editing approaches that avoid double-strand breaks
• Novel delivery systems to enhance efficiency in inner ear cells

The recent establishment of an international expert consensus on gene therapy for hereditary hearing loss provides a valuable framework for advancing these therapeutic strategies, emphasizing standardized patient selection, delivery approaches, and safety monitoring [32] [33]. This consensus, developed through a modified Delphi process involving 46 multidisciplinary experts, offers critical guidance for translating basic research findings into clinical applications [32].

This case study contributes important empirical data to the broader field of HITI research, demonstrating that target site selection remains a critical determinant of success and that region-specific optimization may be necessary for different therapeutic targets. The protocols and analytical approaches described here provide a foundation for further optimization of HITI-based strategies for hereditary hearing loss and other genetic disorders.

Navigating HITI Challenges: Strategies for Enhancing Efficiency and Safety

Homology-Independent Targeted Insertion (HITI) has emerged as a promising CRISPR/Cas9-based genome editing tool that exploits the non-homologous end joining (NHEJ) DNA repair pathway, enabling transgene integration in both dividing and non-dividing cells. Unlike homology-directed repair (HDR), which requires a sister chromatid template and is confined to specific cell cycle phases, HITI offers cell cycle-independent integration, presenting significant advantages for therapeutic applications [5]. However, recent investigations have revealed substantial variability in HITI efficiency across different genomic loci and target cells, posing challenges for its consistent application in gene therapy and drug development.

This application note synthesizes empirical evidence from high-efficiency and low-efficiency HITI case studies to provide researchers with a structured framework for evaluating, predicting, and optimizing HITI integration efficiency. By comparing successful CAR-T cell engineering with problematic hearing loss gene correction, we extract critical parameters influencing HITI outcomes and provide standardized protocols for efficiency assessment.

Quantitative Analysis of HITI Efficiency Across Studies

Comparative Efficiency Metrics

Table 1: Quantitative Comparison of HITI Efficiency Across Model Systems

Study Model	Target Gene/Locus	Target Cell Type	Reported Efficiency	Key Outcome Measures
CAR-T Cell Manufacturing [5]	TRAC locus	Primary human T cells	~80% purity post-CEMENT	Yield: 5.5×10⁸–3.6×10⁹ CAR+ T cells; Functional antigen-specific cytotoxicity
SLC26A4 Gene Correction [20]	c.919-2A>G variant	HEK293T cells	0.15% HITI integration	Minimal correction insufficient for therapeutic benefit

Critical Parameters Influencing HITI Outcomes

Table 2: Experimental Parameters Correlated with HITI Efficiency

Parameter	High-Efficiency Conditions	Low-Efficiency Conditions	Impact on Efficiency
Genomic Locus	TRAC locus (euchromatin, accessible)	SLC26A4 c.919-2 region (likely restrictive chromatin)	High variability: >1000-fold difference
Delivery System	Maxcyte GTx electroporation + nanoplasmid DNA	Not specified	Critical for primary cell viability and editing
Enrichment Strategy	CEMENT (DHFR-FS + methotrexate)	None described	2.3-8 fold enrichment achievable
Cell Type	Activated primary T cells	Immortalized cell line	Primary cells can outperform established lines
DNA Template	Nanoplasmid with R6K origin, antibiotic-free selection	Conventional plasmid design	Backbone optimization crucial

Experimental Protocols for HITI Efficiency Evaluation

Core HITI Workflow for Primary Human T Cells

Day 0: T Cell Activation

• Isolate primary human T cells via negative selection using EasySep Human T Cell Isolation Kit
• Activate cells with Dynabeads Human T-Activator CD3/CD28 at 1:1 ratio
• Culture in TexMACS media supplemented with IL-7 (12.5 ng/ml) and IL-15 (12.5 ng/ml) plus 3% human male AB Serum
• Maintain cell concentration at ~1.5×10⁶/ml using appropriate G-Rex culture vessels

Day 2: Electroporation and HITI Integration

• Magnetically remove Dynabeads and count cells
• Wash cells once in Electroporation Buffer (Maxcyte)
• Resuspend cells at 2×10⁸/ml for electroporation
• Prepare RNP complex: Wildtype Cas9 (61 µM) and sgRNA (125 µM) mixed 1:1 volume, incubate 10 minutes at room temperature
• Add nanoplasmid DNA (3 mg/ml) to RNP complex, incubate ≥10 minutes to pre-cut plasmid
• Electroporate using Maxcyte GTx (Expanded T cell 4 protocol for activated T cells)
• Rest cells in electroporation buffer for 30 minutes post-electroporation
• Transfer to final G-Rex vessels with complete media

Days 3-14: Selection and Expansion

• For CEMENT enrichment: Add methotrexate (FDA-approved DHFR inhibitor) to culture media
• Continue culture with IL-7/IL-15 supplementation, expanding volume to maintain concentration
• Monitor cell growth and CAR expression daily from day 5 onward
• Harvest cells for analysis and infusion at day 14 [5]

HITI Efficiency Assessment Protocol

Next-Generation Sequencing Analysis

• Design primers flanking the targeted integration site
• Amplify target region from genomic DNA (minimum 100ng input)
• Prepare sequencing libraries using compatible NGS kit
• Sequence on Illumina platform to achieve >10,000x coverage
• Analyze reads for precise HITI integration versus indels
• Calculate efficiency as: (HITI-integrated reads / total aligned reads) × 100 [20]

Functional Integration Assessment

• For CAR-T cells: Flow cytometry analysis using target antigen or protein L staining
• Quantitative PCR to assess copy number variation
• ddPCR-based safety profiling for off-target genomic toxicity
• In vivo tumor control assays in appropriate disease models [5]

Visualization of HITI Workflows and Decision Pathways

HITI Experimental Workflow

HITI Integration Mechanism

The Scientist's Toolkit: Essential Research Reagents

Table 3: Key Research Reagent Solutions for HITI Experiments

Reagent/Catalog	Supplier	Function in HITI Workflow	Application Notes
Wildtype Cas9	Integrated DNA Technologies	CRISPR nuclease for DSB generation	Use at 61µM final concentration; 2:1 molar ratio with sgRNA
TRAC sgRNA	Integrated DNA Technologies	Guides Cas9 to TRAC locus	Sequence: GGGAATCAAAATCGGTGAAT; HPLC purify for higher efficiency
Nanoplasmid DNA	Nature Technology	HITI donor template with CAR construct	R6K origin, antibiotic-free selection; optimized for gene therapy
EasySep T Cell Kit	STEMCELL Technologies	Negative selection of human T cells	Maintains cell viability superior to positive selection methods
T-Activator CD3/CD28	Thermo Fisher	T cell activation and expansion	Use at 1:1 bead-to-cell ratio; remove before electroporation
Maxcyte GTx System	Maxcyte	Clinical-scale electroporation	GMP-compatible; enables high viability post-electroporation
IL-7/IL-15	Miltenyi Biotec	T cell culture cytokines	Maintains central memory phenotype; use at 12.5 ng/ml each

The stark contrast between high-efficiency CAR-T cell engineering and low-efficiency SLC26A4 correction underscores that HITI success depends on multiple interdependent parameters. Researchers should prioritize: (1) comprehensive genomic locus assessment including chromatin accessibility studies before target selection; (2) utilization of optimized non-viral delivery systems that maintain primary cell viability; and (3) implementation of selection strategies like CEMENT to overcome moderate integration efficiency. These protocols provide a standardized framework for evaluating HITI efficiency across experimental systems, enabling more predictable outcomes for therapeutic development.

Homology-independent targeted insertion (HITI) has emerged as a powerful CRISPR/Cas9-based technique for targeted transgene integration in primary human T cells, offering advantages over homology-directed repair (HDR) through its cell cycle-independent mechanism utilizing non-homologous end joining (NHEJ) [5] [3]. However, initial HITI editing efficiencies typically yield mixed cell populations requiring purification to achieve therapeutically relevant cell doses. To address this challenge, CRISPR EnrichMENT (CEMENT) has been developed as a streamlined methodology for enriching successfully edited chimeric antigen receptor (CAR) T cells to high purity levels [5].

The CEMENT platform integrates two complementary approaches: (1) the HITI mechanism for efficient transgene knock-in, and (2) a metabolic selection system utilizing a mutant dihydrofolate reductase (DHFR-FS) that confers resistance to methotrexate (MTX) [5] [34]. This combined strategy enables researchers to rapidly achieve cell populations with approximately 80% CAR positivity, representing a significant advancement for manufacturing non-viral CAR-T cells at clinical scale [5]. This application note details the implementation of CEMENT with DHFR-FS selection markers, providing standardized protocols for researchers developing HITI-based cell therapies.

CEMENT Workflow and Mechanism

Conceptual Framework and Experimental Timeline

The CEMENT methodology follows a sequential process beginning with HITI-mediated knock-in and culminating in metabolic selection. The figure below illustrates the integrated workflow and temporal progression from initial editing to final enriched cell product.

Molecular Mechanism of DHFR-FS Selection

The DHFR-FS selection system employs a mutant human dihydrofolate reductase enzyme containing L22F and F31S substitutions that confer resistance to methotrexate inhibition while retaining catalytic function [34]. The diagram below illustrates the metabolic pathway and inhibitory mechanism.

Quantitative Performance Data

CEMENT Enrichment Efficiency

Table 1: Performance Metrics of CEMENT Enrichment in HITI-Edited CAR-T Cells

Parameter	Pre-Selection	Post-CEMENT Selection	Fold Change	Assessment Method
CAR+ Purity	~10-35%	~80%	2.3-8x	Flow cytometry [5]
Cell Yield	Variable	5.5×10⁸–3.6×10⁹ CAR+ cells	N/A	Cell counting [5]
Viability Post-MTX	>90%	>80% maintained	<10% reduction	Trypan blue exclusion [5]
MTX Resistance Threshold	0.05 µM (lethal to wild-type)	0.75 µM (tolerated by DHFR-FS+)	15x	Dose-response curves [34]
Selection Timeline	N/A	7-10 days	N/A	Daily monitoring [5] [34]

Comparison of Enrichment Strategies

Table 2: Comparison of Selection Platforms for Engineered T-Cells

Selection Method	Efficiency	Clinical Applicability	Technical Complexity	Impact on Cell Yield
DHFR-FS/MTX (CEMENT)	High (~80% purity)	High (FDA-approved drug)	Moderate	Minimal reduction [5]
Surface Marker (tEGFR/tNGFR)	High (>90% purity)	Moderate (requires clinical-grade Abs)	High (additional processing)	Significant reduction [3]
Endogenous Locus Knock-in	Variable (locus-dependent)	High (no external elements)	High (complex design)	Variable [3]
Feeder Cell Co-culture	Low-Moderate	Low (inconsistency concerns)	Low	Unpredictable [3]

Research Reagent Solutions

Table 3: Essential Reagents for Implementing CEMENT Selection

Reagent/Catalog	Specifications	Function in Protocol	Example Vendor/Reference
Nanoplasmid Vector	R6K origin, ~430 bp backbone, antibiotic-free selection	HITI donor template with CAR and DHFR-FS	Nature Technology [5] [3]
CRISPR/Cas9 Components	Wild-type Cas9 (61 µM), TRAC-targeting sgRNA	Targeted DSB generation at TRAC locus	Integrated DNA Technologies [5]
Electroporation System	Maxcyte GTx, Expanded T Cell 4 protocol	RNP and nanoplasmid delivery	Maxcyte [5] [3]
Cell Culture Media	TexMACS + 12.5 ng/mL IL-7/IL-15 + 3% human AB serum	T cell expansion and maintenance	Miltenyi Biotec [5]
Selection Agent	Methotrexate (0.1 µM working concentration)	Selective pressure for DHFR-FS+ cells	Pharmaceutical grade [5] [34]
Activation Reagents	CD3/CD28 Dynabeads (1:1 ratio)	T cell activation pre-editing	Thermo Fisher Scientific [5]

Standardized CEMENT Protocol

HITI Knock-in and CEMENT Enrichment

Day 0: T Cell Isolation and Activation

• Isolate primary human T cells from leukopaks using negative selection (EasySep Human T Cell Isolation Kit) [5]
• Activate cells with CD3/CD28 Dynabeads at 1:1 ratio in TexMACS medium supplemented with IL-7 (12.5 ng/mL) and IL-15 (12.5 ng/mL) [5]
• Culture cells in G-Rex vessels at 1.5×10⁶ cells/mL density [5]

Day 2: HITI Electroporation

• Magnetically remove Dynabeads and wash cells once in electroporation buffer [5]
• Prepare RNP complex:
  • Mix wild-type Cas9 (61 µM) with TRAC sgRNA (125 µM) at 2:1 molar ratio
  • Incubate 10 minutes at room temperature
  • Add HITI nanoplasmid DNA (3 mg/mL) containing CAR and DHFR-FS
  • Incubate additional 10 minutes to permit RNP-mediated linearization [5]
• Electroporate 5×10⁶ cells per reaction using Maxcyte GTx (Expanded T Cell 4 protocol) [5]
• Rest cells in electroporation buffer for 30 minutes post-electroporation before returning to culture media [5]

Day 4-12: Methotrexate Selection

• Add methotrexate to final concentration of 0.1 µM on day 4 post-electroporation [5] [34]
• Maintain selection for 7-10 days, monitoring cell density and viability daily
• Adjust culture volume to maintain 1.5×10⁶ cells/mL density [5]
• Remove methotrexate by thorough washing when CAR+ purity reaches ~80% (typically by day 14) [5]

Critical Optimization Parameters

Electroporation Conditions

• Cell concentration: 2×10⁸ cells/mL in electroporation buffer [5]
• DNA concentration: 3 mg/mL nanoplasmid [5]
• Cas9:gRNA ratio: 2:1 molar ratio [5]
• Post-electroporation handling: 30-minute rest in buffer before media transfer [5]

Methotrexate Selection Window

• Initiation timing: 48 hours post-electroporation [5]
• Concentration titration: Test 0.05-0.1 µM for optimal selection with minimal toxicity [34]
• Duration: 7-10 days based on enrichment progression [5]
• Viability monitoring: Expect >80% viability in successfully edited populations [5]

Troubleshooting Guide

Table 4: Common CEMENT Implementation Challenges and Solutions

Problem	Potential Causes	Recommended Solutions
Low Knock-in Efficiency	Suboptimal RNP:DNA ratio	Titrate RNP:DNA ratio (1:1 to 3:1); verify nanoplasmid cutting with validation assay [3]
Poor Post-Selection Viability	Excessive MTX concentration or duration	Titrate MTX (0.05-0.1 µM); reduce selection duration to 5-7 days [34]
Incomplete Enrichment	Insufficient MTX concentration; low starting knock-in efficiency	Increase MTX to 0.1 µM; verify DHFR-FS expression pre-selection [5]
Reduced Cell Expansion	Over-confluent culture; cytokine depletion	Maintain 1.5×10⁶ cells/mL density; replenish IL-7/IL-15 every 2-3 days [5]
High Wild-type Cell Survival	Delayed selection initiation	Begin MTX selection 48 hours post-electroporation [5]

The CEMENT platform with DHFR-FS selection represents a robust methodology for enriching HITI-edited CAR-T cells to therapeutically relevant purity levels. By leveraging the metabolic selection advantage conferred by DHFR-FS against methotrexate-mediated toxicity, researchers can consistently achieve approximately 80% CAR+ populations suitable for clinical application [5]. This integrated approach addresses a critical bottleneck in non-viral CAR-T cell manufacturing by combining the high efficiency of HITI knock-in with straightforward pharmaceutical-based selection. The protocols outlined herein provide a standardized framework for implementing this technology, enabling reproducible manufacturing of engineered T-cell products with reduced complexity and cost compared to viral transduction methods [5] [3].

Recent advancements in CRISPR-Cas technology have paved the way for more precise and predictable genome engineering through homology-independent mechanisms. This application note explores the strategic implementation of microhomology (µH) and tandem repeats in template design to enhance the efficiency and precision of homology-independent targeted insertion (HITI). We detail protocols for designing and implementing µH-based repair arms, supported by quantitative data demonstrating significant improvements in frame retention and reduction of unintended genomic alterations. Within the broader context of HITI research, these methodologies enable robust transgene integration and precise point mutations across diverse cell types, including non-dividing cells and clinically relevant primary T-cells.

The precise integration of transgenes using CRISPR-Cas technology holds great promise for biotechnology and gene therapy, but maintaining genomic integrity remains challenging [35]. While homology-directed repair (HDR) requires large homology arms and is restricted to proliferating cells, non-homologous end joining (NHEJ) and microhomology-mediated end joining (MMEJ) pathways can result in unintended alterations at transgene-genome borders [35]. Naturally occurring MMEJ repair signatures, often characterized by three adjacent base-pair microdeletions, account for 20-25% of all clinically pathogenic sequence variants [35]. Harnessing this natural MMEJ mechanism for frame-retaining double-strand break (DSB) repair of coding sequences offers significant biotechnological opportunities.

Microhomologies are short, homologous sequences (typically 2-20 bp) that flank DSB sites and facilitate repair through annealing-based mechanisms. The strategic placement of µH sequences in donor templates leverages the cell's endogenous MMEJ pathway for precise genomic integrations. Furthermore, tandem repeats of these µH sequences have been shown to significantly enhance the predictability and efficiency of repair outcomes by providing multiple annealing points for the cellular repair machinery [35]. This approach is particularly valuable for HITI-based strategies, which exploit the NHEJ pathway for integration independent of homologous recombination, working throughout the cell cycle and in non-dividing cells [5] [3].

Key Principles and Quantitative Analysis

Predictability of Microhomology-Mediated Repair

Deep learning models pretrained on DNA repair outcomes, such as inDelphi, can accurately predict editing outcomes at the interface between endogenous DSB edges and exogenous donor DNA [35]. When the inDelphi model predicted a µH-mediated 4-bp deletion as the major editing outcome for an example sequence, adding the 3 bp present on the left of the cut site to the sequence right of the cut pivoted the most frequent predicted outcome toward a 3-bp deletion [35]. Further repeating these 3-bp sequences in tandem increased the proportion of predicted editing outcomes using the inserted artificial µH from 52% to 62% [35]. Computational analysis of 250,000 putative guide RNA target loci on human chromosome 1 revealed that the use of artificial µH during DNA repair increases with the number of tandem repeats, plateauing at five tandem repeats [35].

Table 1: Influence of Tandem Repeat Number on Microhomology Usage

Number of Tandem Repeats	Predicted µH Usage	Experimental Validation
1 repeat	52%	Not tested
3 repeats	58%	Not tested
5 repeats	62% (plateau)	73% (left junction), 78% (right junction)

Impact on Integration Precision and Efficiency

The strategic implementation of µH tandem repeat repair arms significantly reduces DNA trimming at both genomic and transgene boundaries. Experimental data comparing NHEJ-mediated integration (0× µH) versus MMEJ-mediated integration (4× 3-bp µH) demonstrates the substantial benefit of µH arms [35]. While integration efficiencies were comparable (9.3% for NHEJ vs. 10.7% for MMEJ), amplicon sequencing revealed dramatic differences in precision [35]. NHEJ-based approaches resulted in extensive deletions at the genomic integration site in 95% of reads, with all remaining reads showing substantial trimming of the transgene cassette [35]. In contrast, using µH tandem repeat repair arms decreased DNA trimming both into the genome and into the repair cassette, with over 50% of reads free from any deletions in either direction [35].

Table 2: Performance Comparison of NHEJ vs. µH-Mediated Integration

Parameter	NHEJ (0× µH)	MMEJ (4× 3-bp µH)
Integration Efficiency	9.3%	10.7%
Genomic Deletions	95% of reads	<50% of reads
Transgene Trimming	100% of reads	<50% of reads
Frame Retention	Low	High (46-63% of reads)
Predictability	Low	High (r=0.81-0.97)

Local sequence context strongly influences µH usage during DNA repair. In silico simulation with the inDelphi HEK293 model for over 10 million gRNAs across the human genome revealed variations in predicted repair outcomes driven by µH composition, particularly linked to the nucleotide at position -4 (counting the NGG protospacer-adjacent motif as nucleotides 0-2) [35]. Specifically, guanine (G) at position -4 was predicted to enhance integration over cytosine (C) [35].

Experimental Protocols

Protocol 1: Designing µH Tandem Repeat Repair Arms

Principle: Create optimal microhomology-based repair arms using computational prediction and empirical validation to ensure precise genomic integration.

Materials:

• inDelphi or similar deep learning model (e.g., Pythia design tool) [35]
• Target genomic sequence with PAM site
• Plasmid donor vector with type IIS restriction sites (e.g., PaqCI) [35]

Procedure:

• Sequence Analysis: Identify the genomic target sequence, including the region 20 bp upstream and downstream of the Cas9 cut site.
• µH Identification: Use inDelphi to predict natural microhomologies flanking the DSB. The algorithm typically identifies 3-6 bp sequences immediately adjacent to the cut site that demonstrate high prediction scores for MMEJ usage [35].
• Tandem Repeat Design: Synthesize 3-6 bp µH sequences as tandem repeats (typically 3-5 repeats) flanking the transgene cassette. The optimal number of repeats is typically five, as this achieves plateau efficiency [35].
• Template Construction: Clone µH tandem repeats invertedly at both ends of the donor cassette in a plasmid containing inverted type IIS restriction sites (e.g., PaqCI) for precise linearization [35].
• Validation: Verify repair arm sequences by Sanger sequencing before proceeding to cellular experiments.

Protocol 2: HITI-Mediated CAR Integration in T-Cells

Principle: Efficient, non-viral integration of chimeric antigen receptor (CAR) transgenes into the TRAC locus of human T-cells using HITI methodology [5] [3].

Materials:

• Primary human T-cells from fresh leukopaks [5]
• Wildtype Cas9 protein (61 µM, IDT) [5]
• TRAC-targeting sgRNA (125 µM, IDT): 5'-GGGAATCAAAATCGGTGAAT-3' [5]
• Nanoplasmid DNA with CAR expression cassette (3 mg/ml) [5] [3]
• Electroporation system (Maxcyte GTx) [5] [3]
• TexMACS media with IL-7 and IL-15 (12.5 ng/ml each) [5]

Procedure:

• T-Cell Preparation: Isolate T-cells from leukopaks using negative selection (EasySep Human T Cell Isolation Kit). Activate cells with CD3/CD28 Dynabeads at a 1:1 ratio [5].
• RNP Complex Formation: On day 2 post-activation, mix wildtype Cas9 (61 µM) and TRAC sgRNA (125 µM) at a 1:1 volume ratio (2:1 molar ratio) and incubate for 10 minutes at room temperature [5].
• Donor Template Preparation: Add 3-5 µg of nanoplasmid DNA per 5×10^6 cells to the RNP complex and incubate for at least 10 minutes to allow RNP-mediated linearization of the nanoplasmid [5] [3].
• Electroporation: Wash T-cells once in electroporation buffer (Maxcyte) and resuspend at 2×10^8 cells/ml. Combine cell suspension with RNP-nanoplasmid complex and electroporate using the "Expanded T cell 4" protocol on the Maxcyte GTx [5].
• Post-Electroporation Recovery: Rest cells in electroporation buffer for 30 minutes, then transfer to pre-warmed TexMACS media with cytokines [5].
• Enrichment (CEMENT): For purification of CAR-positive cells, implement the CRISPR EnrichMENT (CEMENT) strategy using the DHFR-FS selection system with methotrexate (MTX) treatment, achieving approximately 80% purity [5].

Protocol 3: Enhancing Editing Efficiency with Small Molecules

Principle: Chemical enhancement of NHEJ/MMEJ efficiency using small molecule modulators to improve knock-in outcomes [36].

Materials:

• Small molecule inhibitors: Repsox (HY-13012), Zidovudine (S2579), GSK-J4 (HY-15648B), IOX1 (HY-12304) [36]
• DMSO for compound dissolution
• Appropriate cell culture media

Procedure:

• Preparation of Small Molecules: Reconstitute small molecules in DMSO according to manufacturer's instructions to prepare stock solutions.
• Concentration Optimization: Perform dose-response experiments to determine optimal concentrations for specific cell types. For porcine PK15 cells, the following concentrations were effective: Repsox (optimal concentration determined by viability assay), Zidovudine (effective concentration), GSK-J4 (effective concentration), IOX1 (effective concentration) [36].
• Application: Add optimal concentrations of small molecules to cell culture medium immediately after electroporation.
• Efficiency Assessment: Evaluate editing efficiency 48-72 hours post-treatment via flow cytometry or sequencing. Repsox has demonstrated a 3.16-fold increase in NHEJ-mediated editing efficiency in the Cas9-sgRNA RNP delivery system [36].

Visualization of Workflows and Mechanisms

Microhomology-Mediated Integration Mechanism

HITI Workflow for CAR-T Cell Manufacturing

Research Reagent Solutions

Table 3: Essential Reagents for Microhomology-Based HITI

Reagent/Category	Specific Examples	Function/Application
CRISPR Components	Wildtype Cas9 protein	Creates targeted double-strand breaks at genomic loci [5]
	TRAC sgRNA	Guides Cas9 to T-cell receptor alpha constant locus for targeted integration [5]
Donor Templates	Nanoplasmid DNA	Minimal backbone (∼430 bp) donor vector reduces toxicity and prevents transgene silencing [5] [3]
	PaqMan plasmids	Contain type IIS restriction sites (PaqCI) for precise donor linearization [35]
Delivery Systems	Maxcyte GTx electroporator	Clinical-scale non-viral delivery of RNP and donor templates [5] [3]
Enhancement Compounds	Repsox (TGF-β inhibitor)	Increases NHEJ efficiency 3.16-fold in RNP delivery systems [36]
	Zidovudine, GSK-J4, IOX1	Moderate enhancers of NHEJ efficiency (1.16-1.47-fold) [36]
Enrichment Systems	DHFR-FS selection system	Methotrexate-resistant dihydrofolate reductase for metabolic selection [5] [3]
	tEGFR/tNGFR	Cell surface markers for antibody-based selection [3]
Computational Tools	inDelphi/Pythia	Deep learning models for predicting microhomology usage and designing optimal repair arms [35]
	COSMID/CCTop	In silico tools for gRNA off-target prediction [3]

Homology-Independent Targeted Insertion (HITI) has emerged as a powerful genome editing approach, particularly for therapeutic applications in non-dividing cells like primary human T cells. Unlike Homology-Directed Repair (HDR), which requires a homologous template and active cell division, HITI leverages the non-homologous end joining (NHEJ) pathway, making it cell-cycle independent and thus highly efficient for clinical-scale manufacturing of engineered cell therapies, such as CAR-T cells [5] [37]. However, the application of CRISPR-Cas9 systems—including those used in HITI—carries an inherent risk of unintended genomic alterations, collectively termed genotoxicity [38] [39]. This genotoxicity manifests primarily as off-target editing at sites with sequence similarity to the intended target, and on-target structural variations, including chromosomal aberrations such as translocations, inversions, and large deletions [38] [39]. A comprehensive safety assessment is therefore a critical prerequisite for the clinical translation of HITI-based therapies. This Application Note details standardized protocols for the systematic evaluation of off-target effects and chromosomal instability, providing a framework for researchers to ensure the genomic fidelity of their HITI-edited products.

The tables below summarize key quantitative data on genotoxicity risks and the analytical performance of contemporary detection methods, providing a basis for experimental planning and risk assessment.

Table 1: Genotoxicity Profiles of Genome Editing Tools

Editing Tool	Primary Genotoxicity Concerns	Notable Characteristics	Therapeutic Context
HITI (CRISPR-Cas9)	Off-target indels & structural variations; on-target large deletions & translocations [38] [39]	NHEJ-mediated; cell-cycle independent; allows larger payloads [5]	CAR-T cell manufacturing [5] [37]
HDR (CRISPR-Cas9)	Off-target indels & structural variations; requires cell division [5]	Lower efficiency compared to HITI in T cells [5]	Gene correction, knock-in
Viral Vectors	Insertional mutagenesis, oncogene activation [38]	Random integration; immunogenicity concerns [38]	Commercial CAR-T products

Table 2: Performance Metrics of Key Off-Target Detection Methods

Detection Method	Type	Key Metric/Performance	Primary Use
UNCOVERseq	Genome-wide, unbiased [40]	High sensitivity; based on GUIDE-seq; identifies integration sites [40]	Off-target nomination
rhAmpSeq CRISPR Analysis	Targeted, amplicon-based [40]	Detects small indels and chromosomal aberrations; high-throughput confirmation [40]	Off-target confirmation
CIRCLE-seq	In vitro, genome-wide [39]	High sensitivity; dose-response capable; lacks chromatin context [39]	Pre-clinical nomination
Change-seq	In vitro, genome-wide [39]	Unbiased; high sensitivity [39]	Pre-clinical nomination
GUIDE-seq	Cell-based, genome-wide [39]	Unbiased; accounts for chromatin structure [39]	Off-target nomination

Experimental Protocols

A Dual-Method Strategy for Off-Target Assessment

A robust off-target assessment employs a two-stage process: nomination (discovery) and confirmation, often using orthogonal methods to maximize sensitivity and reliability [39] [40].

Protocol: Off-Target Nomination Using UNCOVERseq

UNCOVERseq is a next-generation sequencing method derived from GUIDE-seq that provides unbiased, genome-wide nomination of potential off-target sites [40].

Procedure:

• Cell Preparation and Transfection: Cultivate the target cells (e.g., primary human T cells). Electroporate the cells with a complex of Cas9 ribonucleoprotein (RNP) and the HITI donor template, along with a proprietary, blunt-ended, double-stranded oligonucleotide tag ("GUIDE-seq oligo") [40].
• Genomic DNA Extraction: After 48-72 hours, harvest the cells and extract high-molecular-weight genomic DNA using a magnetic bead-based cleanup system.
• Library Preparation and Sequencing: Shear the gDNA to an average fragment size of 300 bp. Prepare sequencing libraries using an end-repair, A-tailing, and adapter ligation workflow. Enrich for tag-integration sites via PCR and sequence the libraries on a high-throughput platform (e.g., Illumina) [40].
• Data Analysis: Process the sequencing data through a standardized bioinformatics pipeline. Align reads to the reference genome and identify the genomic locations of the integrated GUIDE-seq tag, which mark potential double-strand break sites. These sites are then compiled into a list of nominated off-targets for confirmation [40].

Protocol: Off-Target Confirmation Using rhAmpSeq

The rhAmpSeq CRISPR Analysis System is a targeted amplicon sequencing solution used to confirm and quantify editing events (indels and aberrations) at the nominated off-target loci [40].

Procedure:

• Panel Design: Design two sets of PCR primers for each nominated off-target site and the on-target site. The first set (outer primers) amplifies the locus of interest from gDNA. The second set (inner primers), containing rhAmpSeq sequencing adapters and sample barcodes, is used for a subsequent nested PCR.
• Library Construction: Amplify gDNA from edited and control cells using the designed rhAmpSeq panel in a nested PCR workflow. This approach enhances specificity and reduces background noise.
• Sequencing and Analysis: Pool the amplified libraries and sequence them. Use integrated analysis software to align the sequences, call variants, and quantify the frequency of insertions, deletions, and other structural variations at each targeted site [40].

Protocol: Cytogenetic Analysis of Chromosomal Aberrations

This protocol provides a method for preparing and analyzing metaphase chromosome spreads to detect gross structural chromosomal aberrations (e.g., chromatid breaks, fragments, and translocations) resulting from CRISPR-Cas9 nuclease activity [41].

Reagents:

• Colcemid solution (10 µg/mL)
• Hypotonic solution (0.075 M Potassium Chloride, pre-warmed to 37°C)
• Freshly prepared, ice-cold fixative (3:1 ratio of Methanol:Glacial Acetic Acid)
• Phosphate-Buffered Saline (PBS)
• ProLong Gold Antifade reagent with DAPI

Procedure:

• Cell Culture and Metaphase Arrest:
  • Culture the HITI-edited cells and appropriate control cells under standard conditions.
  • Approximately 1.5 cell cycles after editing, add colcemid to the culture medium to a final concentration of 0.2 µg/mL. Incubate for 2 hours at 37°C to arrest cells in metaphase [41].
  • Note: Prolonged colcemid incubation (>2 hours) can lead to over-condensed chromosomes, complicating analysis.

• Cell Harvesting:

  • Gently detach the cells (both adherent and floating) and transfer them to a 15 mL conical tube.
  • Centrifuge at 186 × g for 5 minutes at room temperature (RT) and carefully discard the supernatant [41].

• Hypotonic Treatment:

  • Resuspend the cell pellet gently in 10 mL of pre-warmed hypotonic solution and incubate for 20 minutes at 37°C. This step causes cells to swell.
  • Add 1 mL of fresh, ice-cold fixative to the tube and mix gently by inversion.
  • Centrifuge at 186 × g for 5 minutes at RT and discard the supernatant [41].

• Fixation:

  • Resuspend the cell pellet in 5 mL of ice-cold fixative and incubate for 10 minutes at RT.
  • Repeat the centrifugation and fixation steps at least twice for a total of three fixations to ensure clean, debris-free chromosomes.

• Slide Preparation:

  • After the final fixation, resuspend the pellet in a small volume (e.g., 0.5-1 mL) of fresh fixative.
  • Drop the cell suspension onto clean, pre-chilled microscope slides from a height of about 20-30 cm. Allow the slides to air-dry completely in a dark, dust-free environment.
  • Stain the chromosomes with 10 µL of ProLong Gold with DAPI and apply a coverslip.

• Microscopy and Scoring:

  • Visualize the metaphase spreads using a high-resolution microscope equipped with a DAPI filter set and a 63x or 100x oil-immersion objective.
  • Score a minimum of 100 well-spread metaphases per experimental condition for the presence of chromosomal aberrations. Document representative images for each type of aberration observed [41].

The Scientist's Toolkit: Essential Research Reagents

Table 3: Key Reagents for HITI Genotoxicity Assessment

Reagent / Solution	Function	Application Context
CRISPR-Cas9 RNP	Generates the targeted double-strand break for HITI insertion.	Core HITI editing; required for all genotoxicity assessments.
HITI Donor Template (Nanoplasmid)	Carries the transgene (e.g., CAR) for insertion; contains Cas9 cut sites.	HITI editing; optimized for high yield and reduced silencing [5].
UNCOVERseq Oligo	A short, double-stranded DNA tag that integrates into DSB sites for off-target nomination.	Off-target nomination via UNCOVERseq/GUIDE-seq [40].
rhAmpSeq Panel	A set of target-specific primers for amplicon sequencing of nominated off-target sites.	High-throughput confirmation and quantification of off-target editing [40].
Colcemid	A microtubule inhibitor that arrests cells in metaphase.	Chromosomal aberration assay; essential for collecting mitotic cells [41].
Hypotonic Solution (KCl)	Causes cells to swell, dispersing the chromosomes for clearer visualization.	Chromosomal aberration assay; step prior to fixation [41].
Methanol:Acetic Acid Fixative	Preserves the chromosomal morphology and prepares cells for dropping onto slides.	Chromosomal aberration assay; requires fresh preparation [41].

Workflow Diagram

The following diagram illustrates the integrated experimental workflow for a comprehensive genotoxicity assessment of HITI-edited products, from cell preparation to final analysis.

The safe clinical application of HITI technology depends on a thorough and multi-faceted evaluation of genotoxicity. By implementing the dual-strategy approach outlined here—employing sensitive, orthogonal methods like UNCOVERseq and rhAmpSeq for off-target profiling, alongside classical cytogenetics for chromosomal aberration analysis—researchers can build a robust safety dossier for their HITI-engineered therapies. This comprehensive assessment is aligned with regulatory expectations [40] and is instrumental in mitigating risks, thereby paving the way for the successful development of safer and more effective gene and cell therapies.

Homology-independent targeted insertion (HITI) represents a transformative approach for engineering therapeutic cells, including chimeric antigen receptor (CAR) T-cells. Unlike homology-directed repair (HDR), which requires cell division and is active only during the S and G2 phases of the cell cycle, HITI utilizes the non-homologous end joining (NHEJ) pathway, the primary DNA repair mechanism for double-stranded breaks throughout the entire cell cycle [15] [3]. This fundamental characteristic makes HITI particularly valuable for therapeutic applications as it enables efficient gene insertion in both dividing and non-dividing primary human T-cells, potentially streamlining and accelerating manufacturing processes [3] [8].

The application of HITI for inserting a therapeutically relevant GD2-CAR transgene into the T cell receptor alpha constant (TRAC) locus using CRISPR/Cas9 and nanoplasmid DNA has demonstrated significant advantages over HDR-mediated approaches, yielding at least twice as many correctly modified GD2-CAR-T cells [15]. When combined with post-editing enrichment strategies such as CRISPR EnrichMENT (CEMENT), this platform can generate clinically relevant doses of CAR-T cells, ranging from 5.5 × 10⁸ to 3.6 × 10⁹ cells from a starting population of 5 × 10⁸ T cells [15]. This technical advance provides a fully non-viral platform for guided CAR insertion that could significantly increase access to CAR-T cell therapies by reducing manufacturing costs and complexity associated with viral vectors [8].

Electroporation Parameter Optimization for HITI

Electroporation is a critical step for introducing CRISPR/Cas9 ribonucleoprotein (RNP) complexes and donor DNA into primary T-cells. Optimal electroporation parameters are essential for achieving high knock-in efficiency while maintaining cell viability and function. The following section details key parameters and optimized protocols based on recent research.

Key Electroporation Parameters

Experimental data from HITI-based CAR-T cell generation have identified several critical parameters that require optimization for successful gene insertion. The table below summarizes the core parameters and their optimized ranges for T-cell engineering.

Table 1: Optimized Electroporation Parameters for HITI in Primary Human T-Cells

Parameter	Optimized Setting	Impact on Outcomes	Experimental Notes
Cell Concentration	2 × 10⁸ cells/mL [15]	Affects viability and editing efficiency; lower concentrations may reduce electroporation stress	Cells should be in log-phase growth and highly viable pre-electroporation
Cas9 Concentration	61 µM [15]	Sufficient for efficient DNA cleavage; higher concentrations may increase toxicity	Wild-type Cas9 protein complexed with sgRNA at 2:1 molar ratio
sgRNA Concentration	125 µM [15]	Guides Cas9 to target locus (e.g., TRAC); critical for specific targeting	Target sequence: TRAC 5'-GGGAATCAAAATCGGTGAAT-3' [15]
DNA Template	Nanoplasmid DNA (3 mg/mL) [15]	Higher yields compared to dsDNA; reduced toxicity compared to conventional plasmids	~450bp backbone with R6K origin and antibiotic-free selection [15] [3]
Cas9:gRNA Ratio	2:1 molar ratio [15]	Affects RNP complex formation and cutting efficiency	Pre-incubate 10 min at room temperature before adding DNA
Electroporation Buffer	Specific Genome Editing Buffer [42]	Formulated for gene-editing payloads; improves viability and knock-in efficiency	Gibco CTS Xenon Genome Editing Buffer designed for CRISPR-Cas9 applications
Post-Pulse Recovery	Immediate resuspension in pre-warmed culture medium [15]	Critical for membrane resealing and cell survival	Resting in electroporation buffer decreases viability

Protocol: HITI-Mediated CAR Insertion via Electroporation

Day -1: T-Cell Isolation and Activation

• Isolate primary human T-cells from leukopaks using negative selection (EasySep Human T Cell Isolation Kit) [15].
• Activate cells with Dynabeads Human T-Activator CD3/CD28 at a 1:1 bead-to-cell ratio [15].
• Culture in TexMACS medium supplemented with IL-7 (12.5 ng/mL) and IL-15 (12.5 ng/mL) with 3% human male AB serum [15].
• Maintain cells at approximately 1.5 × 10⁶ cells/mL in G-Rex plates or flasks.

Day 0: Electroporation Preparation

• Confirm cell viability exceeds 90% prior to electroporation.
• Magnetically remove Dynabeads from culture [15].
• Wash cells once in appropriate electroporation buffer (Maxcyte Electroporation Buffer or equivalent) [15].
• Resuspend cells at 2 × 10⁸ cells/mL in electroporation buffer [15].

Day 0: RNP Complex Formation and Electroporation

• Prepare RNP complex by mixing wild-type Cas9 (61 µM) and sgRNA (125 µM) at a 2:1 molar ratio in a sterile tube [15].
• Incubate for 10 minutes at room temperature to allow RNP complex formation.
• Add nanoplasmid DNA (3 mg/mL) to the RNP complex and incubate for at least 10 minutes to allow RNP-mediated linearization of the donor DNA [15].
• Combine cell suspension with RNP-DNA complex and transfer to appropriate electroporation chamber.
• Electroporate using optimized parameters:
  • Maxcyte GTx: Use "Expanded T cell 4" protocol for activated T-cells [15]
  • CTS Xenon System: Programmable parameters - voltage: 500-2500 V, pulse width: 1-30 ms, pulse number: 1-10 pulses, pulse interval: 500-1000 ms [42]
• Immediately after electroporation, transfer cells to pre-warmed complete culture medium.

Days 1-14: Post-Electroporation Culture and Expansion

• Culture electroporated cells in IL-7/IL-15 supplemented medium.
• Monitor cell density and expand culture volume to maintain 1-2 × 10⁶ cells/mL.
• Assess editing efficiency and CAR expression at 72 hours post-electroporation via flow cytometry.
• Continue expansion for 14 days to achieve therapeutic dose.

Figure 1: HITI Workflow for CAR-T Cell Manufacturing. This diagram illustrates the step-by-step process for homology-independent targeted insertion of CAR transgenes into primary human T-cells.

Closed-System Scale-Up Methodologies

Transitioning from research-scale electroporation to clinically relevant manufacturing requires robust, closed-system technologies that maintain sterility while ensuring consistent performance. Recent advances in electroporation instrumentation have enabled seamless scale-up of HITI-based cell engineering processes.

Scale-Up Platforms and Performance

Table 2: Comparison of Electroporation Systems for Scale-Up

System	Scale/Volume	Throughput	Key Features	Clinical Compliance
CTS Xenon Electroporation System [42]	1-25 mLUp to 2.5×10⁹ cells	7-22 minutes for 5-25 mL	Closed, modular design; User-programmable parameters; Peltier precooling (10-30°C)	GMP-compliant; 21 CFR Part 11 capable with SAE upgrade
Maxcyte GTx [15] [3]	Flow-through systemClinical scale	Variable based on scale	Preset protocols for different cell types; GMP-compatible; Aseptic closed processing	Designed for clinical manufacturing
Neon Transfection System [42]	100 µLResearch scale	Rapid processing	Small-scale optimization; Limited to research use	Research use only

Scale-Up Protocol: Manufacturing-Scale HITI CAR-T Cell Production

Pre-Production: Process Transfer and Validation

• Transfer optimized electroporation parameters from research-scale system (e.g., Neon System) to clinical-scale system (e.g., CTS Xenon or Maxcyte GTx) [42].
• Validate performance comparability by assessing:
  • Post-electroporation viability (target: >70%)
  • Knock-in efficiency (target: >20% CAR+)
  • Cell composition (CD4/CD8 ratio maintenance)
• Establish acceptance criteria for critical quality attributes (CQAs) and critical process parameters (CPPs).

Closed-System Electroporation at Scale

• Prepare cells following the same isolation and activation protocol as research scale.
• For CTS Xenon System:
  • Use Xenon MultiShot Cartridge for 5-25 mL volumes [42]
  • Set cell concentration to 20-100 × 10⁶ cells/mL [42]
  • Program optimized parameters: Voltage (500-2500 V), Pulse width (1-30 ms), Pulse number (1-10), Pulse interval (500-1000 ms) [42]
  • Utilize integrated cell mixer (60 rpm) during processing
• For Maxcyte GTx:
  • Use CL1.1 assembly for large-scale processing [15]
  • Apply "Expanded T cell 4" protocol for activated T-cells [15]
• Maintain closed-system processing through sterile welding of tubing sets.

Post-Electroporation Processing and Enrichment

• Immediately transfer electroporated cells to expansion vessels (e.g., G-Rex 100M) [15] [3].
• Implement CEMENT (CRISPR EnrichMENT) selection if using DHFR-FS system:
  • Add methotrexate (MTX) to culture medium [15]
  • Optimize MTX exposure duration and concentration [15] [3]
  • Monitor enrichment efficiency (target: ~80% CAR+ cells) [15]
• Expand cells for 14 days, monitoring cell density, viability, and CAR expression.

Quality Control and Release Testing

• Perform flow cytometry for CAR expression and cell composition.
• Conduct ddPCR for vector copy number assessment [15] [3].
• Implement off-target analysis using GUIDE-seq or rhAMPSeq [3].
• Assess genomic integrity through karyotyping or ddPCR for chromosomal translocations [3].

The Scientist's Toolkit: Essential Reagents and Materials

Successful implementation of HITI-based cell engineering requires specific reagent systems optimized for this application. The following table details essential components and their functions.

Table 3: Essential Research Reagents for HITI-Based Cell Engineering

Reagent/Category	Specific Examples	Function	Notes
Electroporation System	CTS Xenon System [42], Maxcyte GTx [15]	Delivery of RNP and donor DNA to cells	Clinical-scale systems enable closed processing
Electroporation Buffers	CTS Xenon Genome Editing Buffer [42], Maxcyte Electroporation Buffer [15]	Maintain cell viability during electroporation	Formulated specifically for gene editing applications
CRISPR Components	Wild-type SpCas9 [15], TRAC-targeting sgRNA [15]	Target-specific genomic cleavage	sgRNA sequence: 5'-GGGAATCAAAATCGGTGAAT-3'
Donor DNA Template	Nanoplasmid DNA [15] [3]	CAR transgene delivery	~450bp backbone with R6K origin; reduced silencing
Selection System	DHFR-FS (Dihydrofolate ReductaseL22F/F31S) [15] [3]	Enrichment of successfully edited cells	Confers resistance to methotrexate
Cell Culture Media	TexMACS [15] with IL-7/IL-15	Supports T-cell growth and expansion	Serum-free formulation for clinical applications
Cell Activation	Dynabeads Human T-Activator CD3/CD28 [15]	Pre-electroporation T-cell activation	Magnetic removal possible before electroporation

HITI Mechanism and Molecular Biology

Understanding the molecular mechanism of HITI is essential for proper experimental design and troubleshooting. The following diagram and description outline the key steps in homology-independent targeted insertion.

Figure 2: HITI Molecular Mechanism. This diagram illustrates the CRISPR-Cas9-mediated double-strand break formation in both the genomic target and donor DNA template, followed by integration via the NHEJ repair pathway.

The HITI mechanism leverages the cell's endogenous NHEJ pathway, which is active throughout the cell cycle, unlike HDR which requires replicating cells [15] [3]. The process begins with the formation of a CRISPR-Cas9 ribonucleoprotein (RNP) complex that simultaneously targets both the genomic locus (e.g., TRAC) and an internal cut site within the nanoplasmid donor DNA [15] [3]. This coordinated cutting creates compatible ends at both locations that are recognized by the NHEJ repair machinery, particularly the Ligase IV complex [15]. The linearized donor DNA containing the CAR transgene is then integrated into the genomic locus through direct end-joining, without requiring homology arms [3]. This mechanism enables highly efficient gene insertion independent of cell cycle status, making it particularly valuable for primary T-cell engineering where controlling replication states is challenging [8].

Analytical Methods and Quality Assessment

Rigorous quality control is essential for clinical translation of HITI-engineered cell products. The following analytical approaches should be implemented to ensure product safety and efficacy.

On-Target Editing Assessment

• Flow Cytometry: Monitor CAR expression and cell surface markers (e.g., TCRab knockout) [42]
• ddPCR: Quantify vector copy number and assess chromosomal translocations [3]
• Next-Generation Sequencing: Evaluate on-target editing precision and identify potential indels [3]

Off-Target Analysis

• In Silico Prediction: Utilize tools like COSMID and CCTop during gRNA design phase [3]
• Empirical Testing: Implement GUIDE-seq, CIRCLE-seq, or rhAMPSeq for comprehensive off-target nomination [3]
• Variant-Aware Assessment: Employ CRISPRme to account for human genetic diversity in off-target prediction [3]

Genomic Integrity Evaluation

• Karyotyping: Monitor chromosomal abnormalities and aneuploidy [3]
• TLA (Targeted Locus Amplification): Unbiased assessment of insertion sites [3]
• Long-Range PCR: Detect large deletions or rearrangements at target locus [3]

Functional Potency Assays

• In Vitro Cytotoxicity: Measure tumor cell killing capacity
• Cytokine Secretion: Quantify IFNg, IL-2 release upon antigen exposure
• Proliferation Capacity: Assess expansion potential and persistence

This comprehensive approach to process optimization, scale-up, and quality assessment provides a robust framework for implementing HITI-based cell engineering in both research and clinical manufacturing settings. The detailed protocols and parameters outlined enable reproducible generation of therapeutic-grade engineered cells with potential for broad application in adoptive cell therapy.

HITI in the Ecosystem: Benchmarking Safety, Efficacy, and Future Alternatives

Within the broader scope of advancing homology-independent targeted insertion (HITI) research, selecting the appropriate genome-editing strategy is crucial for experimental success and therapeutic application. HITI and homology-directed repair (HDR) represent two fundamentally different cellular mechanisms for integrating genetic material following CRISPR-Cas9-induced double-strand breaks (DSBs). HDR is a high-fidelity but cell-cycle-dependent pathway, active primarily in the S and G2 phases, whereas HITI leverages the more ubiquitous and cell-cycle-independent non-homologous end joining (NHEJ) pathway [5] [3] [14]. This Application Note provides a structured, data-driven comparison of these technologies in two clinically relevant primary human cell types: T-cells and induced pluripotent stem cells (iPSCs).

Quantitative Performance Comparison

The choice between HITI and HDR involves significant trade-offs in efficiency, cell-type suitability, and outcome precision. The following table summarizes key performance metrics from recent studies.

Table 1: Head-to-Head Comparison of HITI and HDR Performance in Primary Human Cells

Parameter	HITI (Homology-Independent Targeted Insertion)	HDR (Homology-Directed Repair)
Primary DNA Repair Pathway	Non-Homologous End Joining (NHEJ) [3]	Homology-Directed Repair (HDR) [43]
Cell Cycle Dependence	Independent; effective in both dividing and non-dividing cells [5] [44]	Dependent; primarily active in S/G2 phases, inefficient in non-dividing cells [43] [14]
Editing Efficiency in T-Cells	High; ~2-fold higher cell yields compared to HDR for anti-GD2 CAR knock-in into the TRAC locus [5]	Moderate; limited by lower efficiency and impaired cell viability/expansion post-editing [5]
Editing Efficiency in iPSCs	Very Low; as low as 0.15% reported for correcting the SLC26A4 c.919-2A>G variant [45]	Varies; often the preferred method for precise edits in iPSCs, though efficiency can be limiting [43]
Typical Junction Outcomes	Prone to small indels; can be precise with optimized designs [5] [35]	Typically precise, clean junctions with long homology arms [43]
Ideal Application Profile	High-yield integration of large cassettes (e.g., CARs) in primary cells, especially non-dividing or hard-to-transfect cells [5] [3]	Precise point mutations, small insertions, or modifications in dividing cells where high fidelity is critical [43]

Detailed Experimental Protocols

HITI Protocol for CAR Knock-in in Primary Human T-Cells

This protocol, adapted from Balke-Want et al., details the steps for generating clinical-scale CAR-T cells using HITI [5].

Day 0: T-Cell Isolation and Activation

• Isolate primary human T-cells from a leukopak using negative selection (e.g., EasySep Human T Cell Isolation Kit).
• Activate cells using Dynabeads Human T-Activator CD3/CD28 at a 1:1 bead-to-cell ratio.
• Culture cells in TexMACS medium supplemented with 12.5 ng/mL IL-7 and 12.5 ng/mL IL-15, with 3% human AB serum.

Day 2: CRISPR-Cas9 Electroporation

• Magnetically remove activation beads and wash cells.
• Prepare RNP Complex: Mix wild-type Cas9 protein (61 µM) and TRAC-targeting sgRNA (125 µM) at a 1:1 volume ratio (2:1 molar ratio). Incubate for 10 minutes at room temperature.
• Add Donor Template: Add HITI nanoplasmid donor DNA (3 mg/mL) containing the CAR transgene and an internal cut site to the RNP complex. Incubate ≥10 minutes to allow RNP to linearize the nanoplasmid.
• Electroporation: Resuspend T-cells (2 x 10^8 cells/mL) in electroporation buffer. Combine cell suspension with the RNP-DNA complex and electroporate using the Maxcyte GTx (e.g., "Expanded T cell 4" protocol for activated T-cells). For non-activated T-cells, use the "Resting T cell 14-3" protocol and stimulate with beads post-electroporation.
• Post-Electroporation Recovery: Rest cells in the electroporation assembly for 30 minutes before transferring to final G-Rex culture vessels.

Days 3-14: Cell Expansion and CEMENT Enrichment

• Expand cells in complete TexMACS medium with cytokines.
• For CRISPR EnrichMENT (CEMENT), enrich CAR-positive cells by adding methotrexate (MTX) to the culture. This selects for cells that have successfully integrated the DHFR-FS (dihydrofolate reductaseL22F/F31S) mutant gene co-expressed with the CAR [5].
• Continue culture for 14 days total, maintaining cell concentration at ~1.5 x 10^6 cells/mL.

HDR Protocol for Gene Correction in iPSCs

This protocol outlines a standard approach for HDR-mediated correction in iPSCs, highlighting challenges encountered with HITI in this cell type [45].

• Cell Preparation: Culture and maintain human iPSCs in an undifferentiated state using feeder-free conditions and essential supplements.
• Design of Donor Template: For HDR, design a donor vector (e.g., AAV, plasmid) containing the corrective sequence flanked by long homology arms (>500 bp) specific to the target locus.
• CRISPR-Cas9 Transfection: Co-transfect iPSCs with a plasmid encoding Cas9 and a sgRNA, or electroporate with pre-complexed RNP. The SLC26A4 study found electroporation to be necessary, with optimization required for efficiency and survival [45].
• Screening and Clonal Selection: After allowing time for editing and repair, dissociate cells and seed at low density for clonal expansion.
• Genotype Analysis: Screen individual clones via PCR and Sanger sequencing to identify clones with the desired homozygous correction. Next-generation sequencing is recommended for unbiased efficiency quantification [45].

Signaling Pathways and Experimental Workflows

The diagram below illustrates the fundamental cellular mechanisms of HITI and HDR, providing a logical framework for understanding their functional differences.

The Scientist's Toolkit: Research Reagent Solutions

Successful genome editing requires carefully selected components. The table below lists key reagents and their functions based on the protocols discussed.

Table 2: Essential Reagents for HITI and HDR Workflows

Reagent / Tool	Function / Principle	Example Application
Nanoplasmid DNA	Minimal backbone (~450 bp) donor vector; reduces cytotoxicity and prevents transgene silencing [5] [3]	HITI-based CAR knock-in in T-cells [5]
CRISPR EnrichMENT (CEMENT)	Post-editing selection using co-integrated selection marker (e.g., DHFR-FS) and drug (e.g., Methotrexate) to enrich for edited cells [5]	Achieving ~80% purity of HITI-edited CAR-T cells [5]
Electroporation Platform (e.g., Maxcyte GTx)	Clinically relevant, semi-closed system for efficient RNP and donor DNA delivery into sensitive primary cells [5] [3]	Large-scale clinical manufacturing of CAR-T cells [5]
Modified Cas9 (e.g., HiFi Cas9)	High-fidelity variant of Cas9; reduces off-target effects and cellular toxicity [46]	Editing with cytotoxic circular dsDNA donors in stem cells [46]
Single-Stranded Oligodeoxynucleotide (ssODN)	Short, single-stranded DNA donor template for introducing point mutations or small insertions via HDR [43] [46]	Precise point mutation installation in hESCs [46]

The empirical data clearly demonstrates that HITI and HDR are not universally applicable but are specialized for distinct contexts. HITI excels in primary human T-cells, enabling high-yield, clinical-scale manufacturing of engineered cell therapies like CAR-T cells, largely due to its independence from the cell cycle [5] [3]. In stark contrast, HITI showed markedly low efficiency in iPSCs for a specific genomic correction, suggesting that HDR remains the default strategy for precise editing in these cells, though its efficiency is also not guaranteed [45].

The selection between these technologies must be guided by the target cell type, the desired edit, and the required precision. For rapid, high-yield integration of large transgenes in hard-to-edit primary cells, HITI offers a powerful and potentially safer alternative [3]. For applications in dividing cells where flawless sequence integration is paramount, HDR, despite its lower efficiency, is currently the necessary path. Future developments in microhomology-based designs [35] and improved delivery systems will continue to refine this critical choice for researchers and drug developers.

Homology-independent targeted insertion (HITI) represents a advanced CRISPR/Cas9-based genome editing technique that facilitates the integration of therapeutic transgenes without requiring homologous recombination. Unlike homology-directed repair (HDR), HITI utilizes the non-homologous end joining (NHEJ) pathway, making it effective in both dividing and non-dividing cells [5]. This application note details protocols for using HITI to restore protein function and rescue disease phenotypes, with specific examples from genetic disorders and CAR-T cell engineering.

Key Principles of HITI Mechanism

HITI functions through a CRISPR/Cas9-mediated double-strand break at a specific genomic locus, followed by the integration of a donor DNA cassette flanked by Cas9 target sequences. The key distinction from HDR lies in its exploitation of the NHEJ pathway, which is active throughout the cell cycle and does not require a sister chromatid template [5]. This mechanism allows for the insertion of large transgenes, such as full-length therapeutic genes or chimeric antigen receptors (CARs), into defined safe harbor loci like the T cell receptor alpha constant (TRAC) locus [5].

Successful application requires careful selection of the target locus and the use of optimized donor constructs. The donor plasmid is typically designed with Cas9 cut sites on both ends, enabling it to be linearized by the same Cas9 ribonucleoprotein (RNP) complex that creates the genomic break. This simultaneous cutting of the genome and donor plasmid promotes direct ligation and integration via NHEJ [5] [47].

Quantitative Analysis of HITI Efficiency

The following tables summarize key quantitative data from recent HITI applications, demonstrating its efficiency across different experimental models and target genes.

Table 1: HITI Editing Efficiency Across Different Target Genes and Cell Types

Target Gene	Cell/Tissue Type	Application	Reported HITI Efficiency	Key Outcome Measures
TRAC [5]	Primary Human T-cells	Anti-GD2 CAR Insertion	High cell yields; 2-fold greater than HDR	Generated 5.5 × 108–3.6 × 109 CAR+ T cells; Therapeutically relevant doses
Rhodopsin (Rho) [47]	Mouse Rod Photoreceptors	Gene Correction for Retinitis Pigmentosa	80% to 90% of transduced cells	Suppressed degeneration; Induced visual restoration in mutant mice
SLC26A4 [20]	Experimental Cell Model	Correction of c.919-2A>G Variant	0.15% of sequencing reads	Low efficiency; Indicates locus-specific challenges for HITI
Prph2 [47]	Mouse Photoreceptors	Gene Therapy Development	Effective integration demonstrated	Validated workflow for another target gene

Table 2: Comparative Analysis of HITI vs. HDR for CAR-T Cell Manufacturing [5]

Parameter	HITI-mediated CAR Knock-in	HDR-mediated CAR Knock-in
DNA Repair Pathway	NHEJ	HDR
Cell Cycle Dependence	Independent	Dependent on cell division
Primary Cell Yields	High (at least 2-fold greater than HDR)	Limiting for clinical application
Clinical Scale Manufacturing	Suitable (5.5 × 108–3.6 × 109 CAR+ T cells)	Challenging due to impaired viability and expansion
Target Locus	TRAC	TRAC

Experimental Protocols

Objective: To integrate an anti-GD2 CAR into the TRAC locus of primary human T-cells using HITI for clinical-scale CAR-T cell manufacturing.

Materials:

• Primary Human T-cells: Isolated from leukopaks using negative selection.
• Activation Reagent: Dynabeads Human T-Activator CD3/CD28.
• Culture Media: TexMACS media supplemented with IL-7 (12.5 ng/ml) and IL-15 (12.5 ng/ml), plus 3% human male AB Serum.
• CRISPR Components: Wildtype Cas9 protein (61 µM) and TRAC-specific sgRNA (125 µM).
• Donor Template: Nanoplasmid DNA (3 mg/ml) containing the anti-GD2 CAR expression cassette flanked by Cas9 cut sites.
• Electroporation System: Maxcyte GTx with appropriate processing assemblies.

Methodology:

• T-cell Isolation and Activation: Isolate T-cells via negative selection. Activate using CD3/CD28 beads at a 1:1 bead-to-cell ratio.
• Electroporation Preparation: On day 2 post-activation, magnetically remove beads. Wash cells and resuspend in electroporation buffer at 2 × 10⁸ cells/ml.
• RNP Complex Formation: Mix Cas9 protein and sgRNA at a 2:1 molar ratio (2:1 sgRNA:Cas9) and incubate for 10 minutes at room temperature.
• Donor DNA Complexing: Add nanoplasmid DNA to the RNP complex and incubate for at least 10 minutes to allow RNP-mediated cutting of the plasmid.
• Electroporation: Combine cell suspension with RNP-nanoplasmid complex. Electroporate using the "Expanded T cell 4" protocol on the Maxcyte GTx.
• Post-electroporation Handling: Rest cells in electroporation buffer for 30 minutes before transferring to final culture vessels.
• Culture and Expansion: Culture cells in G-Rex vessels, maintaining density at approximately 1.5 × 10⁶ cells/ml over a 14-day process with regular medium exchanges.

Validation:

• Flow cytometry analysis of CAR expression.
• Functional cytotoxicity assays against GD2-positive tumor cells.
• ddPCR-based copy number analysis for genomic safety assessment.

Objective: To correct dominant mutations in the Rhodopsin gene via HITI in mouse models of autosomal dominant retinitis pigmentosa (AdRP).

Materials:

• HITI Construct: Plasmid or AAV vectors containing SpCas9, gRNA targeting mouse Rho, and donor cassette with normal Rho sequence.
• Experimental Animals: Rho+/P23H mutant mice or Rho+/AcGFP knock-in mice.
• Injection Equipment: 33G blunt-ended microsyringe for subretinal delivery.
• Electroporation System: NEPA21 Super Electroporator with tweezer-type electrodes.

Methodology:

• Construct Design: Clone HITI-treatment cassette containing:
  • SpCas9 driven by a Rho promoter (e.g., pRho2k/300bp-SpCas9).
  • gRNA expression vector (pBAsi-U6-mRho-gRNA).
  • Donor cassette with normal Rho coding sequence flanked by Cas9 target sites.
• Subretinal Injection: At postnatal day (P)0, inject 0.4 µL of plasmid DNA solution into the subretinal space of mouse pups.
• In Vivo Electroporation: Immediately following injection, apply electrical pulses using tweezer electrodes with parameters (120 V poring pulse, 20 V transfer pulse).
• Tissue Analysis: Harvest retinas at P14-P56 for:
  • Immunohistochemical analysis of Rho expression and photoreceptor structure.
  • Single-cell genotyping to evaluate allelic donor insertion.
  • Optomotor response (OMR) testing for visual function assessment.

Validation:

• Quantification of HITI efficiency via single-cell genotyping.
• Assessment of photoreceptor preservation through retinal histology.
• Measurement of visual function restoration using optomotor response assays.

The Scientist's Toolkit: Essential Research Reagents

Table 3: Key Research Reagent Solutions for HITI Experiments

Reagent/Category	Specific Examples	Function/Purpose
CRISPR Components	Wildtype Cas9 protein, TRAC-specific sgRNA (5'-GGGAATCAAAATCGGTGAAT-3') [5]	Creates targeted double-strand breaks at genomic locus of interest
Donor Templates	Nanoplasmid DNA with R6K origin, antibiotic-free selection [5]	Provides therapeutic transgene for integration; optimized for reduced silencing
Delivery Systems	Maxcyte GTx electroporator [5], Adeno-associated virus (AAV) vectors [47]	En efficient introduction of CRISPR components and donor DNA into cells
Cell Culture Supplements	IL-7, IL-15, human AB Serum [5]	Supports T-cell expansion and viability post-electroporation
Selection Markers	Dihydrofolate reductaseL22F/F31S (DHFR-FS) [5]	Enriches for successfully edited cells using methotrexate resistance
Animal Models	RhoP23H/P23H mice [47]	Provides in vivo system for validating therapeutic efficacy of HITI

Workflow and Pathway Visualizations

HITI Experimental Workflow

HITI Molecular Mechanism

Homology-Independent Targeted Insertion (HITI) represents a significant advancement in CRISPR-Cas9-based genome editing, leveraging the non-homologous end joining (NHEJ) pathway for targeted transgene integration. Unlike homology-directed repair (HDR), which is restricted to specific cell cycle phases, HITI operates independently of the cell cycle, making it particularly valuable for modifying non-dividing or slowly dividing primary cells such as human T lymphocytes [5]. While this approach enables high-yield production of engineered CAR-T cells and other therapeutic products, comprehensive safety profiling is paramount for clinical translation. This application note details standardized protocols for assessing the on-target genomic integrity and off-target activity of HITI-based genome editing, providing a framework for researchers and drug development professionals to ensure the safety of genetically modified cellular therapies.

DNA Repair Pathways in Genome Editing

Diagram Title: DNA Repair Pathways for CRISPR-Cas9-Induced DSBs

Understanding the competitive landscape of DNA repair pathways is fundamental to evaluating HITI safety. When CRISPR-Cas9 induces a double-strand break (DSB), multiple repair mechanisms are activated simultaneously [48]. The non-homologous end joining (NHEJ) pathway operates throughout the cell cycle, beginning with the rapid binding of the Ku70-Ku80 heterodimer to DNA ends, followed by recruitment of DNA-PKcs and final ligation by DNA Ligase IV (LIG4/XRCC4 complex) [48]. This pathway typically results in small insertions or deletions (indels). In contrast, homology-directed repair (HDR) is restricted to S/G2 cell cycle phases and involves extensive 5' to 3' end resection by the MRN complex and CtIP, followed by RPA binding, RAD51 nucleoprotein filament formation, and strand invasion using a homologous template [48]. Microhomology-mediated end joining (MMEJ) represents a third pathway that utilizes short microhomologous sequences for alignment, typically resulting in larger deletions [48]. HITI strategically exploits the NHEJ pathway for targeted transgene integration, bypassing the cell cycle limitations of HDR [5].

Quantitative Safety Data from HITI Studies

Table 1: Summary of Quantitative Safety Data from Genome Editing Studies

Assessment Category	Experimental Finding	Quantitative Result	Significance/Impact
On-Target HITI Efficiency	CAR knock-in into TRAC locus using nanoplasmid DNA [5]	2-fold higher cell yields compared to HDR	Enables clinical-scale manufacturing (5.5×10⁸–3.6×10⁹ CAR+ T cells)
Kilobase-Scale Deletions	AZD7648 with long-read sequencing at multiple loci [49]	2.0 to 35.7-fold increase; up to 43.3% of reads at GAPDH	Previously undetected by short-read sequencing
Megabase-Scale Alterations	AZD7648 in primary human HSPCs & organoids [49]	Up to 47.8% of cells showed chromosome arm loss	Highlights risk of large structural variations
Off-Target Editing	AAV-CRISPR in neonatal mouse liver (F9 gene) [50]	Only 1 putative insertion detected across 118 reads from >100 predicted sites	Confirms high specificity with proper gRNA design
Genomic Rearrangements	DNA-PKcs inhibitor (AZD7648) with ddPCR & scRNA-seq [49]	33% eGFP loss; 52 Mb copy number fractional loss up to -0.074	Demonstrates potential for catastrophic chromosomal damage

Recent investigations reveal that strategies to enhance editing efficiency, particularly through DNA repair pathway modulation, can introduce unanticipated genomic risks. The DNA-PKcs inhibitor AZD7648, while effective at increasing HDR efficiency, was found to dramatically increase the frequency of kilobase-scale and megabase-scale deletions, chromosome arm loss, and translocations [49]. These large-scale chromosomal alterations often evade detection by standard short-read sequencing methods, creating a significant safety blind spot [49]. In one striking example, editing with AZD7648 resulted in a 52 Mb copy number fractional loss of -0.074 when measured by ddPCR, indicating loss of an entire chromosome arm [49]. In primary human upper airway organoids and hematopoietic stem and progenitor cells (HSPCs), scRNA-seq revealed that AZD7648 treatment caused gene expression loss consistent with chromosome arm loss in up to 47.8% and 22.5% of cells, respectively [49]. These findings underscore the critical need for orthogonal assessment methods that can detect a broad spectrum of genomic alterations.

Experimental Protocols for Safety Profiling

Protocol 1: Comprehensive On-Target Integrity Assessment

Diagram Title: On-Target Genomic Integrity Assessment Workflow

Purpose: To detect precise integration, small indels, and large-scale genomic alterations at the intended target locus.

Materials:

• Genomic DNA from edited cells
• Long-range PCR kit (e.g., Q5 Hot Start High-Fidelity DNA Polymerase)
• Short-range PCR reagents
• Oxford Nanopore Technologies (ONT) or PacBio long-read sequencing platform
• Droplet digital PCR (ddPCR) system and reagents
• Bioanalyzer or TapeStation for quality control

Procedure:

• Genomic DNA Extraction: Isolate high-molecular-weight genomic DNA from edited cells using a method that preserves large DNA fragments (e.g., phenol-chloroform extraction). Assess DNA integrity via pulsed-field gel electrophoresis or genomic DNA ScreenTape analysis.
• Long-Range PCR Amplification: Design primers flanking the integration site to generate 3.5-5.9 kb amplicons [49].
  • PCR Conditions: Follow manufacturer recommendations with extended extension times (e.g., 1 minute per kb).
  • Verify amplicon size and purity by agarose gel electrophoresis.
• Long-Read Sequencing Library Preparation:
  • Utilize ONT ligation sequencing kit according to manufacturer instructions.
  • Load library onto MinION or PromethION flow cell.
  • Sequence for approximately 48 hours or until sufficient coverage (>100x) is achieved.
• Short-Range Amplicon Sequencing:
  • Amplify target site with short primers (<500 bp amplicon).
  • Prepare Illumina sequencing library using dual indexing.
  • Sequence on MiSeq or similar platform with 2×250 bp paired-end reads.
• ddPCR Copy Number Analysis:
  • Design TaqMan assays targeting regions 1 Mb, 10 Mb, and the chromosome arm beyond the integration site [49].
  • Perform ddPCR according to manufacturer protocol with reference assay.
  • Calculate copy number variation using QuantaSoft analysis software.
• Bioinformatic Analysis:
  • For long-read data: Map reads to reference genome using minimap2, identify structural variants using Sniffles or similar tools.
  • For short-read data: Align with BWA-MEM, call small indels using GATK HaplotypeCaller.
  • For ddPCR data: Calculate fractional copy number loss relative to control samples.

Expected Results: This orthogonal approach enables detection of precise integration (short-read), kilobase-scale deletions (long-read), and megabase-scale alterations (ddPCR). Studies show that while short-read sequencing may indicate >90% HDR efficiency, long-read sequencing often reveals substantial large deletions (up to 43.3% of reads) that were previously undetected [49].

Protocol 2: Off-Target Editing Analysis

Purpose: To identify and validate off-target editing events across the genome.

Materials:

• GUIDE-seq oligonucleotide adaptor
• Tn5 transposase and tagmentation reagents
• Hybridization capture baits spanning predicted off-target sites
• High-fidelity PCR enzymes
• Illumina sequencing platform

Procedure:

• GUIDE-seq Library Preparation:
  • Electroporate cells with Cas9 RNP plus 100 pmol of GUIDE-seq oligo [51].
  • Culture cells for 72 hours post-electroporation.
  • Extract genomic DNA and shear to 300-500 bp fragments.
  • Prepare sequencing library with incorporation of GUIDE-seq-specific primers.
  • Amplify library and purify using SPRI beads.
• ONE-seq or DEUX-seq Library Preparation:
  • For ONE-seq, utilize the manufacturer's protocol for in vitro cleavage and sequencing [51].
  • For DEUX-seq, follow the donor-assisted workflow for enhanced sensitivity.
• Hybrid Capture Validation:
  • Design biotinylated RNA baits targeting nominated off-target sites from GUIDE-seq/ONE-seq.
  • Prepare Illumina sequencing library from edited cell genomic DNA.
  • Perform hybrid capture using the bait panel according to manufacturer instructions.
  • Sequence captured libraries on Illumina platform.
• Bioinformatic Analysis:
  • For GUIDE-seq: Use the published GUIDE-seq analysis pipeline to identify integration sites.
  • For hybrid capture data: Align reads to reference genome, call variants with sensitive parameters, and filter for sites with significant editing above background.

Expected Results: Well-designed gRNAs typically show minimal off-target activity. In one comprehensive study of AAV-delivered CRISPR in mouse liver, only one putative off-target insertion was detected across 118 reads spanning >100 computationally predicted sites [50]. GUIDE-seq typically identifies 0-10 potential off-target sites depending on gRNA specificity.

Protocol 3: Single-Cell RNA Sequencing for Chromosomal Aberrations

Purpose: To detect very large-scale chromosomal alterations, including chromosome arm losses, resulting from genome editing.

Materials:

• Single-cell RNA sequencing platform (10x Genomics Chromium)
• Viable single-cell suspension from edited cells
• scRNA-seq library preparation kit
• Bioanalyzer or TapeStation

Procedure:

• Single-Cell Preparation:
  • Ensure >90% cell viability confirmed by trypan blue exclusion.
  • Adjust cell concentration to 700-1,200 cells/μl in appropriate buffer.
• Library Preparation:
  • Follow 10x Genomics Chromium Single Cell 3' Reagent Kit user guide.
  • Generate gel beads-in-emulsion (GEMs) containing single cells.
  • Perform reverse transcription, cDNA amplification, and library construction.
• Sequencing:
  • Pool libraries and sequence on Illumina NovaSeq or similar platform.
  • Aim for >50,000 reads per cell minimum.
• Bioinformatic Analysis:
  • Process data using Cell Ranger pipeline for alignment and quantification.
  • Utilize inferCNV or similar tool to identify large-scale copy number variations.
  • Identify regions with coherent patterns of gene expression loss across adjacent genes.

Expected Results: In cells edited with DNA-PKcs inhibitors, scRNA-seq can reveal striking patterns of gene expression loss spanning megabases. One study showed that up to 47.8% of edited upper airway organoid cells lost expression of a 6.5 Mb telomeric segment encompassing 24 genes, consistent with chromosome arm loss [49].

Research Reagent Solutions

Table 2: Essential Reagents for HITI Safety Assessment

Reagent/Category	Specific Examples	Function/Application	Safety Consideration
Off-Target Nomination Assays	GUIDE-seq, ONE-seq, DEUX-seq [51]	Genome-wide, unbiased identification of potential off-target sites	Addresses FDA guidance for multi-method analysis [51]
Long-Read Sequencing	Oxford Nanopore Technologies, PacBio [49]	Detection of large deletions and structural variations	Identifies kilobase-scale events missed by short-read sequencing [49]
Copy Number Assays	Droplet Digital PCR (ddPCR) [49]	Absolute quantification of copy number variations	Detects megabase-scale deletions and chromosome arm loss [49]
Single-Cell Omics	10x Genomics Single Cell RNA-seq [49]	Detection of chromosomal aberrations via expression patterns	Identifies very large-scale alterations in heterogeneous samples [49]
Bioinformatic Tools	Guide Profiler, Guide Select [51]	In silico guide RNA design and variant-aware screening	Early identification of potential off-target sites during design phase [51]
DNA Repair Modulators	AZD7648 (DNA-PKcs inhibitor) [49]	Enhances HDR efficiency but increases genomic risk	Causes large-scale genomic alterations; use with caution [49]

Comprehensive safety profiling of HITI-edited products requires an integrated approach that combines multiple orthogonal assessment technologies. While HITI offers significant advantages for clinical-scale manufacturing of engineered cell therapies, particularly in hard-to-transfect primary cells, thorough evaluation of both on-target integrity and off-target activity is non-negotiable for clinical translation. The emerging evidence that certain efficiency-enhancing strategies can promote catastrophic genomic damage underscores the importance of implementing sensitive detection methods capable of identifying a broad spectrum of genetic alterations. By adopting the standardized protocols outlined in this application note, researchers can more effectively characterize the safety profile of HITI-based genome editing and advance the development of safer genetically modified cellular therapies.

Targeted DNA integration represents a cornerstone of modern genetic engineering, with profound implications for basic research and therapeutic development. While CRISPR-Cas9 systems have revolutionized genome editing, the efficient and precise insertion of large transgenes remains challenging due to the complexities of cellular DNA repair pathways. Homology-independent targeted insertion (HITI) strategies have emerged as powerful alternatives to traditional homology-directed repair (HDR), particularly valuable in non-dividing cells where HDR is inefficient. This application note provides a comparative analysis of three advanced HITI-compatible methodologies: Long-offset Paired Nicking (LOTI), Microhomology-Mediated End Joining (MMEJ), and Prime Editing-based approaches. We present quantitative performance data, detailed experimental protocols, and essential reagent solutions to empower researchers in selecting and implementing these cutting-edge techniques.

Technology Mechanisms

LOTI (Long-Offset Paired Nicking) utilizes Cas9 nickase (Cas9n) to introduce single-strand breaks (nicks) at both genomic and donor DNA loci with offsets ≥200 base pairs, minimizing double-strand breaks (DSBs) and reducing indels while maintaining high knock-in efficiency in somatic cells [52].

MMEJ (Microhomology-Mediated End Joining) exploits cellular repair mechanisms that leverage short homologous sequences (2-25 nt) flanking the DSB. This pathway is independent of traditional HDR machinery and can be enhanced by suppressing key inhibitors like Polymerase θ (Polq) [53].

Prime Editing-based Integration (PAINT) employs a reverse transcriptase fused to Cas9 nickase to generate reverse-transcribed single-stranded micro-homologous overhangs at the transgene cassette, facilitating high-fidelity "copy-and-paste" integration without requiring DSBs [54].

Quantitative Performance Comparison

Table 1: Comparative Performance Metrics of HITI Methods

Method	Max Reported Efficiency	Typical Insert Size Range	Key Advantages	Primary Limitations
LOTI	55% FIX activity restoration in vivo [52]	Large fragments (>1 kb)	Minimal indels; Reduced off-target effects; Works in somatic cells	Requires optimized nicking pairs; Lower efficiency than DSB-based methods
MMEJ	Varies by locus [53]	<1 kb typically	Works in non-dividing cells; Independent of HDR machinery	Microhomology requirements; Deletion patterns at junctions
PAINT 3.0	Up to 85% KI frequency [54]	Up to 2.5 kb demonstrated	Orientation-specific integration; Minimal backbone integration; High fidelity	Complex vector design; Optimization of pegRNAs required
HITI	~80% CAR+ T-cells after enrichment [5]	Large fragments (>5 kb)	Cell cycle-independent; Higher yields than HDR in T-cells	Unpredictable indels at junctions; Reverse integration events

Table 2: DNA Repair Pathway Utilization Across Methods

Method	Primary Repair Pathway	DSB Formation	Cell Cycle Dependence	Key Pathway Modulators
LOTI	Nick repair	No DSBs	Low	Cas9n efficiency; Nick distance
MMEJ	MMEJ/Alt-EJ	Yes	Minimal	Polq (enhancer); MRN complex
PAINT	Primed micro-homologues-assisted integration (PMEJ)	No	Minimal	Reverse transcriptase processivity
Conventional HITI	NHEJ	Yes	None	Ku70/80; DNA-PKcs; Ligase IV

Experimental Protocols

LOTI (Long-Offset Paired Nicking) Protocol

Principle: LOTI introduces targeted integration via paired nicking of genomic DNA and donor template with long-offset nicking guides (≥200 bp apart), enabling precise integration while minimizing DSB-associated indels [52].

Workflow:

• sgRNA Design and Preparation:

  • Design two sgRNAs targeting the same strand of the genomic locus with ≥200 bp offset
  • Design two additional sgRNAs targeting the donor plasmid flanking the insertion cassette
  • Synthesize sgRNAs using in vitro transcription or commercial synthesis

• Donor Template Construction:

  • Clone the transgene of interest into a standard mammalian expression backbone
  • Incorporate LOTI sgRNA target sequences flanking the transgene cassette
  • Prepare high-purity plasmid DNA using endotoxin-free maxiprep kits

• Cell Transfection:

  • Plate HEK293T or other relevant cells at 70-80% confluency in 6-well plates
  • Prepare transfection mixture:
    • 1 µg of each: Cas9n expression plasmid (or Cas9n RNP)
    • 0.5 µg of each sgRNA expression plasmid (or synthetic sgRNAs)
    • 1.5 µg of donor plasmid
    • Lipofectamine 2000 in Opti-MEM
  • Incubate cells with transfection complex for 6-8 hours before media replacement

• Analysis and Validation:

  • Harvest cells 72-96 hours post-transfection
  • Extract genomic DNA for junction PCR analysis
  • Perform flow cytometry for fluorescent reporter integration
  • Confirm precise integration by Sanger sequencing of PCR amplicons

MMEJ-Mediated Knock-in with Polq Suppression

Principle: This approach enhances MMEJ efficiency by suppressing the key MMEJ factor Polq using CasRX, redirecting repair toward HDR and improving knock-in efficiency in embryos and somatic cells [53].

Workflow:

• MMEJ Donor Design:

  • Identify 5-25 bp microhomology arms flanking the DSB site
  • Incorporate the same microhomology sequences into the donor plasmid ends
  • Design donor with 800-1000 bp total homology arms for enhanced efficiency

• Polq Suppression with CasRX:

  • Design CasRX gRNAs targeting Polq mRNA
  • Co-inject/transfect CasRX components with CRISPR-Cas9 system

• Zygote Microinjection (for Animal Models):

  • Prepare injection mixture:
    • Cas9 mRNA (50 ng/µL)
    • Target sgRNA (25 ng/µL)
    • MMEJ donor (20 ng/µL)
    • CasRX mRNA (30 ng/µL)
    • CasRX gRNAs (15 ng/µL)
  • Perform pronuclear injection in mouse or monkey zygotes
  • Transfer embryos to pseudopregnant females

• Somatic Cell Editing:

  • Transfert cells with Cas9 RNP complex + MMEJ donor plasmid
  • Include CasRX components for Polq suppression
  • Analyze knock-in efficiency by flow cytometry or PCR at 72-96 hours

PAINT (Primed Micro-Homologues-Assisted Integration) Protocol

Principle: PAINT utilizes prime editors to generate single-stranded micro-homologous overhangs on excised transgene cassettes, enabling high-efficiency targeted integration through a "copy and paste" mechanism [54].

Workflow:

• pegRNA Design:

  • Design pegRNAs with 25-35 nt RT-template lengths for optimal efficiency
  • Include spacer sequence targeting the donor plasmid
  • Program RT template to encode microhomology to genomic target

• PAINT Donor Construction:

  • Clone transgene into donor vector with generic pegRNA recognition sites
  • Flank transgene with pegRNA target sequences
  • Use high-fidelity assembly methods to avoid mutations

• Cell Electroporation:

  • Prepare RNP complex:
    • 10 µM spCas9-RT fusion protein
    • 30 µM pegRNA
    • 20 µM genomic target sgRNA
    • 2 µg PAINT donor plasmid
  • Electroporate 5×10^5 cells using Neon system (1400V, 20ms, 2 pulses)
  • Plate cells in recovery media with appropriate cytokines

• Analysis and Enrichment:

  • Analyze initial integration efficiency at 5-7 days post-electroporation
  • Enrich for positive cells using FACS or drug selection
  • Validate integration sites by PCR and sequencing

DNA Repair Pathways in Targeted Integration

Cellular DNA repair pathways significantly influence the outcome of genome editing experiments. Understanding these pathways is essential for selecting appropriate gene editing strategies [55] [56].

NHEJ is the predominant DSB repair pathway in mammalian cells, active throughout the cell cycle and frequently resulting in small indels. It involves rapid recognition of DSBs by KU70/80 heterodimers, recruitment of DNA-PKcs, and ligation by DNA Ligase IV [55].

MMEJ utilizes 2-25 bp microhomology sequences flanking the break site for repair, resulting in characteristic deletions. The key enzyme in this pathway is DNA Polymerase θ (Polq), which makes MMEJ a promising target for modulation to improve editing outcomes [53] [56].

HDR provides precise repair using homologous templates but is restricted to the S and G2 phases of the cell cycle, limiting its efficiency in non-dividing cells. HDR requires extensive 5' resection, RAD51 nucleofilament formation, and strand invasion [55].

Prime Editing mechanisms bypass traditional repair pathways by using nicking and reverse transcription to directly write genetic information into target sites, avoiding the competing repair pathways that often compromise editing efficiency [54] [57].

The Scientist's Toolkit: Essential Research Reagents

Table 3: Key Research Reagent Solutions for HITI Methods

Reagent Category	Specific Products/Components	Application & Function	Key Considerations
Editor Proteins	spCas9-RT fusion (PE2) [57], Cas9 nickase (D10A) [52], Wild-type Cas9	Catalytic core for DNA recognition and modification	PE2 offers enhanced efficiency over PE1; Cas9n reduces off-targets
Guide RNAs	pegRNAs (35 nt RT-template optimal) [54], LOTI sgRNAs, MMEJ sgRNAs	Target specification and editing template	pegRNA length optimization critical for PAINT efficiency
Donor Templates	Nanoplasmids [5], dsDNA with microhomology arms, ssODN	Provides template for desired sequence insertion	Nanoplasmids show improved biosafety and efficiency in T-cells
Delivery Systems	Maxcyte GTx electroporator [5], Lipofectamine 2000, AAV6	Introduction of editing components into cells	Electroporation optimal for primary T-cells; Hydrodynamic injection for liver
Pathway Modulators	ART558 (POLQ inhibitor) [56], Alt-R HDR Enhancer V2 (NHEJi) [56], D-I03 (Rad52 inhibitor) [56]	Modulate DNA repair to favor desired outcomes	POLQ inhibition enhances HDR by suppressing MMEJ
Enrichment Systems	DHFR-FS selection [5], Surface marker FACS	Selection of successfully edited cells	DHFR-FS provides MTX resistance for in vivo selection
Cell Culture	TexMACS media [5], IL-7/IL-15 cytokines, Human AB Serum	Support cell viability and expansion post-editing	Cytokine combination critical for primary T-cell expansion

Discussion and Technical Considerations

The comparative analysis of LOTI, MMEJ, and Prime Editing approaches reveals distinct advantages and limitations that guide their application in different research contexts. LOTI's minimal indel formation makes it particularly valuable for therapeutic applications where precision is paramount, though its efficiency may be lower than DSB-based methods. MMEJ strategies offer the advantage of function in non-dividing cells but require careful optimization of microhomology arms and benefit from Polq suppression. Prime Editing approaches, particularly PAINT 3.0, demonstrate remarkable efficiency (up to 85% KI frequency) and precision but require more complex vector design and pegRNA optimization.

For therapeutic applications like CAR-T cell manufacturing, HITI using nanoplasmid DNA has demonstrated impressive scalability, producing 5.5×10^8–3.6×10^9 CAR+ T cells from a single manufacturing process [5]. The non-viral nature of this approach addresses critical bottlenecks in cost and accessibility of cell therapies.

When implementing these technologies, researchers should consider:

• Target locus characteristics - GC content, chromatin accessibility, and endogenous repair patterns
• Cell type - Dividing vs. non-dividing, primary vs. immortalized
• Insert size - MMEJ typically handles smaller inserts while LOTI and PAINT accommodate larger fragments
• Purity requirements - LOTI and PAINT generate fewer off-target integrations than traditional HITI

The emerging trend of combining multiple approaches, such as using Polq suppression to enhance HDR efficiency, demonstrates the value of understanding DNA repair pathways to optimize editing outcomes. As these technologies continue to evolve, they promise to expand the capabilities of precision genome engineering for both basic research and clinical applications.

Regulatory and Manufacturing Considerations for Clinical Translation

Homology-independent targeted insertion (HITI) represents a transformative approach for engineering therapeutic cells, particularly chimeric antigen receptor (CAR) T-cells. Unlike homology-directed repair (HDR), which requires cell division and is limited to specific cell cycle phases, HITI utilizes the non-homologous end joining (NHEJ) pathway, enabling efficient gene integration in both dividing and non-dividing cells [37] [5]. This application note delineates the regulatory and manufacturing framework for implementing HITI-based therapies, providing detailed protocols and analytical methodologies essential for clinical translation. The non-viral nature of this platform significantly reduces manufacturing costs and complexity compared to viral vector-based approaches, while mitigating risks associated with random integration [3] [8].

HITI Manufacturing Workflow

The production of clinical-grade HITI-engineered cell therapies requires a meticulously controlled, scalable process. The following workflow outlines the key stages from raw materials to final product release.

Figure 1: HITI Manufacturing Workflow for Clinical-Scale CAR-T Cell Production

Process Yield and Critical Quality Attributes

Successful clinical manufacturing must yield sufficient quantities of functionally potent cells while maintaining stringent quality standards. The HITI platform, when combined with CRISPR EnrichMENT (CEMENT), consistently generates therapeutically relevant cell doses across multiple donors.

Table 1: Clinical-Scale Manufacturing Yields for HITI-Engineered GD2 CAR-T Cells

Parameter	Donor 1	Donor 2	Donor 3	Therapeutic Relevance
Starting T-cell Population	5 × 108	5 × 108	5 × 108	Standard leukapheresis product
Final CAR+ T-cell Yield	3.6 × 109	5.5 × 108	1.2 × 109	Exceeds commercial dose requirements
CAR Purity Post-CEMENT	~80%	~80%	~80%	Reduces need for further purification
Process Duration	14 days	14 days	14 days	Compatible with clinical timelines

The data demonstrate that HITI/CEMENT generates CAR-T cell numbers ranging from 5.5 × 10⁸ to 3.6 × 10⁹ from a standardized starting population of 5 × 10⁸ T cells, sufficient to meet doses administered in all current commercial CAR products [37]. The consistent achievement of approximately 80% CAR purity post-enrichment significantly reduces manufacturing bottlenecks associated with cell purification.

Experimental Protocols

HITI-Mediated CAR Knock-in in Primary Human T-Cells

This protocol details the precise insertion of an anti-GD2 CAR into the T cell receptor alpha constant (TRAC) locus using CRISPR/Cas9 and nanoplasmid DNA via HITI.

Materials and Reagents

Table 2: Essential Research Reagent Solutions for HITI Engineering

Reagent/Category	Specific Example	Function/Application	Manufacturing Considerations
Nanoplasmid DNA	R6K origin, anti-levansucrase antisense RNA backbone	HITI donor template with reduced silencing	Antibiotic-free selection; ~430bp minimal backbone [3]
Guide RNA	TRAC-targeting: 5'-GGGAATCAAAATCGGTGAAT-3'	Targets Cas9 to TRAC locus for precise insertion	Mismatch base included for optimal on-target performance [37]
Electroporation System	Maxcyte GTx	Clinically relevant electroporation platform	GMP-compatible; preset "Expanded T-cell 4" protocol [3]
Cell Culture Vessels	G-Rex series (Wilson Wolf)	Combined gas-permeable cell growth	Enables scale-up to G-Rex 100M for clinical lots [5]
Enrichment System	DHFR-FS (dihydrofolate reductaseL22F/F31S)	Methotrexate-resistant selection marker	FDA-approved drug enables metabolic selection [37]

Step-by-Step Procedure

• T-cell Isolation and Activation

  • Isolate T-cells from fresh leukopaks using negative selection (EasySep Human T Cell Isolation Kit).
  • Activate cells using Dynabeads Human T-Activator CD3/CD28 at a 1:1 ratio.
  • Culture in TexMACS media supplemented with IL-7 (12.5 ng/ml) and IL-15 (12.5 ng/ml) with 3% human male AB serum.
  • Maintain cells at approximately 1.5 × 10⁶/ml in G-Rex vessels.

• RNP Complex Formation and Electroporation

  • On day 2, magnetically remove Dynabeads and wash cells once in electroporation buffer.
  • Resuspend cells at 2 × 10⁸/ml for electroporation.
  • Form RNP complexes by mixing wildtype Cas9 (61 µM) and sgRNA (125 µM) at a 2:1 molar ratio (vol 1:1).
  • Incubate for 10 minutes at room temperature.
  • Add nanoplasmid DNA (3 mg/ml) to RNP complex and incubate ≥10 minutes to allow RNP to cut nanoplasmid.
  • Electroporate using Maxcyte GTx with "Expanded T cell 4" protocol for activated T-cells.
  • Rest cells in electroporation buffer for 30 minutes post-electroporation before transferring to final G-Rex vessels.

• CEMENT Enrichment and Expansion

  • Initiate methotrexate (MTX) treatment post-electroporation to select for DHFR-FS-expressing cells.
  • Optimize MTX exposure duration to maximize enrichment while maintaining cell viability.
  • Expand cells for 14 days total process duration, maintaining cell concentration and media volume.
  • Monitor CAR expression via flow cytometry, expecting approximately 80% purity post-enrichment.

Analytical and Regulatory Assessment Protocols

Ensuring product safety and quality requires comprehensive genomic safety profiling and rigorous quality control testing.

Figure 2: Comprehensive Safety and Quality Assessment Framework for HITI-Engineered Products

Genomic Safety Assessment

• Off-Target Analysis

  • Utilize in silico tools (COSMID, CCTop) during gRNA design to exclude guides with predicted off-target effects.
  • Employ GUIDE-seq or CIRCLE-seq for empirical identification of potential off-target sites.
  • Implement rhAMP Seq for precise quantification of off-target mutations in final product.
  • Consider human genetic diversity using CRISPRme for variant-aware off-target assessment.

• On-Target Analysis

  • Perform droplet digital PCR (ddPCR) to monitor for chromosome 14 aneuploidy resulting from TRAC locus editing.
  • Utilize Targeted Locus Amplification (TLA) for unbiased assessment of insertion sites.
  • Apply long-read sequencing to detect complex on-target outcomes (large deletions, inversions, insertions).

• Product Characterization and Release Criteria

  • Determine CAR expression percentage via flow cytometry (target >70%).
  • Assess cell viability (target >80%).
  • Evaluate potency through in vitro cytotoxicity assays and cytokine secretion profiles.
  • Confirm sterility through mycoplasma, endotoxin, and microbial testing.

Regulatory and Manufacturing Considerations

The transition from research to clinical application necessitates adherence to Current Good Manufacturing Practices (cGMP) and comprehensive safety profiling. HITI-engineered products must demonstrate consistent quality, purity, and potency while minimizing genomic risks [58].

Critical Process Parameters

• Electroporation Optimization: Parameters including voltage, pulse width, cell concentration, DNA vector concentration, and buffer composition require meticulous optimization and control.
• Vector Design: HITI donor templates should incorporate a single CRISPR cut site, which demonstrates higher knock-in efficiency compared to zero or two cut sites [3].
• Cell Processing: Utilizing non-activated T-cells with HITI may enhance safety profile by reducing chromosomal abnormality risks associated with elevated TP53 expression during activation [3].
• Closed System Manufacturing: Implement semi-closed or closed system electroporation (Maxcyte GTx) connected to G-REX platforms to maintain sterility during scale-up.

Regulatory Documentation

Sponsors must provide comprehensive data packages including:

• Proof of precise targeted integration at intended genomic locus
• Comprehensive off-target analysis using multiple orthogonal methods
• Demonstration of product stability throughout shelf-life
• Validation of enrichment process and final product purity
• Comparability data between HITI-engineered and viral-transduced CAR-T cells

The HITI platform represents a promising approach for overcoming manufacturing limitations of viral vector-based CAR-T therapies. By implementing these detailed protocols and analytical frameworks, researchers and manufacturers can advance HITI-based therapies through clinical development and regulatory approval, ultimately increasing patient access to innovative cell therapies.

Conclusion

HITI has firmly established itself as a powerful and versatile genome-editing platform, particularly for its ability to engineer non-dividing cells and streamline the manufacturing of complex therapies like CAR-T cells. While challenges in integration efficiency and genotoxic risk persist, ongoing innovation in guide RNA design, donor template architecture, and enrichment protocols is rapidly addressing these limitations. The successful application of HITI in preclinical models of retinal dystrophy, hearing loss, and cancer immunotherapy underscores its immense therapeutic potential. Future directions will focus on refining predictive design tools, developing novel delivery systems for in vivo applications, and integrating HITI with other precise editing technologies to achieve unmatched levels of safety and efficacy, ultimately accelerating its path to widespread clinical adoption.

References

• 1. CRISPR-Cas9-mediated homology-directed repair for ... [https://pmc.ncbi.nlm.nih.gov/articles/PMC11531618/]
• 2. Therapeutic homology-independent targeted integration in ... [https://www.nature.com/articles/s41467-022-29550-8]
• 3. Homology-Independent Targeted Insertion (HITI) for ... [https://www.scientificarchives.com/article/homology-independent-targeted-insertion-hiti-for-therapeutic-t-cell-engineering]
• 4. CRISPR-Cas9 homology-independent targeted integration ... [https://pmc.ncbi.nlm.nih.gov/articles/PMC10495553/]
• 5. Homology-independent targeted insertion (HITI) enables ... [https://molecular-cancer.biomedcentral.com/articles/10.1186/s12943-023-01799-7]
• 6. Targeted in vivo gene integration of a secretion-enabled ... [https://www.nature.com/articles/s43856-025-00959-8]
• 7. Characterizing and controlling CRISPR repair outcomes in ... [https://pmc.ncbi.nlm.nih.gov/articles/PMC12623481/]
• 8. Efficient Homology-Independent Solution for Precise Targeted ... [https://techfinder.stanford.edu/technology/efficient-homology-independent-solution-precise-targeted-dna-insertions-human-t-cells]
• 9. In vivo genome editing via CRISPR/Cas9 mediated ... [https://pmc.ncbi.nlm.nih.gov/articles/PMC5331785/]
• 10. Low Efficiency of Homology-Independent Targeted ... [https://pmc.ncbi.nlm.nih.gov/articles/PMC12155412/]
• 11. DeepCRISPR: optimized CRISPR guide RNA design by deep learning | Genome Biology | Full Text [https://genomebiology.biomedcentral.com/articles/10.1186/s13059-018-1459-4]
• 12. Optimizing the DNA Donor Template for Homology-Directed ... [https://pmc.ncbi.nlm.nih.gov/articles/PMC5363683/]
• 13. CRISPR-Cas9: bridging the gap between aging ... [https://www.frontiersin.org/journals/cellular-neuroscience/articles/10.3389/fncel.2025.1681891/full]
• 14. Precise genome-editing in human diseases [https://www.nature.com/articles/s41392-024-01750-2]
• 15. Homology-independent targeted insertion ( HITI ) enables guided CAR ... [https://pmc.ncbi.nlm.nih.gov/articles/PMC10291796/]
• 16. Harmonisation of quality control tests for academic ... [https://www.nature.com/articles/s41409-025-02637-8]
• 17. An optimized workflow for virus-free generation of TRAC- ... [https://www.idtdna.com/page/support-and-education/decoded-plus/an-optimized-workflow-for-virus-free-generation-of-trac-replaced-car-t-cells/]
• 18. Improving CAR T Cell Therapy by Optimizing Critical ... [https://pmc.ncbi.nlm.nih.gov/articles/PMC7518470/]
• 19. How To Design Guide RNA for CRISPR [https://www.synthego.com/guide/how-to-use-crispr/design-grna-crispr/]
• 20. Low Efficiency of Homology-Independent Targeted ... [https://pubmed.ncbi.nlm.nih.gov/40507794/]
• 21. Animal Models for Target Diseases in Gene Therapy [https://pmc.ncbi.nlm.nih.gov/articles/PMC7088656/]
• 22. Nanoplasmid™ Vector System [https://www.aldevron.com/custom-manufacturing/nanoplasmid]
• 23. Nanoplasmid FAQ [https://www.aldevron.com/custom-manufacturing/nanoplasmid/faq]
• 24. A CRISPR-HITI strategy approach to improve CHO cell ... [https://pmc.ncbi.nlm.nih.gov/articles/PMC11624615/]
• 25. In vivo genome editing via CRISPR/Cas9-mediated ... [https://www.nature.com/articles/s41467-024-48092-9]
• 26. Safety and Vision Outcomes Following Gene Therapy for ... [https://pubmed.ncbi.nlm.nih.gov/39786763/]
• 27. NGGT Biotechnology's Gene Therapy NGGT001 Continues ... [https://www.cgtlive.com/view/nggt-biotechnology-gene-therapy-nggt001-continues-encouraging-safety-biettis-crystalline-dystrophy]
• 28. Surgical Approaches to Retinal Gene Therapy: 2025 Update [https://www.mdpi.com/2306-5354/12/10/1122]
• 29. SLC26A4 gene: MedlinePlus Genetics [https://medlineplus.gov/genetics/gene/slc26a4/]
• 30. Mutation spectrum and genotype–phenotype correlation of ... [https://www.nature.com/articles/jhg201412]
• 31. Assessing the Functional Significance of Novel and Rare ... [https://www.mdpi.com/1422-0067/26/21/10732]
• 32. Article International expert consensus on gene therapy for ... [https://www.sciencedirect.com/science/article/pii/S2666634025003137]
• 33. International expert consensus on gene therapy for ... [https://pubmed.ncbi.nlm.nih.gov/41135524/]
• 34. Efficient Selection of Genetically Modified Human T Cells ... [https://pmc.ncbi.nlm.nih.gov/articles/PMC4028078/]
• 35. Precise, predictable genome integrations by deep-learning ... [https://www.nature.com/articles/s41587-025-02771-0]
• 36. Improving the Efficiency of CRISPR/Cas9-Mediated Non ... [https://pmc.ncbi.nlm.nih.gov/articles/PMC12384319/]
• 37. Homology-independent targeted insertion (HITI) enables ... [https://pubmed.ncbi.nlm.nih.gov/37365642/]
• 38. Gene Editing and Genotoxicity: Targeting the Off-Targets [https://pmc.ncbi.nlm.nih.gov/articles/PMC8525370/]
• 39. evaluating and mitigating off-target effects in CRISPR gene ... [https://www.frontiersin.org/journals/bioengineering-and-biotechnology/articles/10.3389/fbioe.2023.1339189/full]
• 40. CRISPR Off-Target Analysis Service | IDT [https://www.idtdna.com/pages/products/crispr-genome-editing/crispr-off-target-analysis-services]
• 41. Quantification of Chromosomal Aberrations in Mammalian ... [https://pmc.ncbi.nlm.nih.gov/articles/PMC10450737/]
• 42. Flexible Solutions that Facilitate Scale-Up [https://www.labmanager.com/large-scale-nonviral-delivery-for-cell-therapy-28283]
• 43. CRISPR-Cas9-mediated homology-directed repair for ... [https://www.sciencedirect.com/science/article/pii/S2162253124002312]
• 44. Targeted in vivo gene integration of a secretion-enabled ... [https://pmc.ncbi.nlm.nih.gov/articles/PMC12241343/]
• 45. Low Efficiency of Homology-Independent Targeted ... [https://www.mdpi.com/1422-0067/26/11/4980]
• 46. Prevalent integration of genomic repetitive and regulatory ... [https://www.nature.com/articles/s42003-025-07539-5]
• 47. Optimization of HITI-Mediated Gene Insertion for ... [https://pmc.ncbi.nlm.nih.gov/articles/PMC11578159/]
• 48. Fine-Tuning Homology-Directed Repair (HDR) for ... [https://pmc.ncbi.nlm.nih.gov/articles/PMC12071731/]
• 49. Genome editing with the HDR-enhancing DNA-PKcs ... [https://www.nature.com/articles/s41587-024-02488-6]
• 50. Comprehensive analysis of off-target and on-target effects ... [https://www.sciencedirect.com/science/article/pii/S2329050124001815]
• 51. SeQure DX Screening Addresses FDA Gene Therapy ... [https://maxcyte.com/resource/sequre-dx-risk-assessment-services-align-with-fda-guidance/]
• 52. Long-offset paired nicking-based efficient and precise ... [https://www.sciencedirect.com/science/article/abs/pii/S0167779925000836]
• 53. CATI: an efficient gene integration method for rodent and ... [https://genomebiology.biomedcentral.com/articles/10.1186/s13059-023-02987-w]
• 54. High-efficiency targeted transgene integration via primed ... [https://www.nature.com/articles/s41421-023-00552-0]
• 55. Prime Editing: Mechanistic Insights and DNA Repair ... [https://www.mdpi.com/2073-4409/14/4/277]
• 56. Comparative analysis of multiple DNA double-strand break ... [https://pmc.ncbi.nlm.nih.gov/articles/PMC12075812/]
• 57. Prime editing for precise and highly versatile genome ... [https://pmc.ncbi.nlm.nih.gov/articles/PMC10989687/]
• 58. Cell Therapy Product Manufacturing Considerations [https://dc.engconfintl.org/cellbasedtherapies_v/104/]